ID: 1056807318

View in Genome Browser
Species Human (GRCh38)
Location 9:89738919-89738941
Sequence CTCAAAAGGAGGCCCAAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056807318_1056807325 -8 Left 1056807318 9:89738919-89738941 CCCTACTTGGGCCTCCTTTTGAG No data
Right 1056807325 9:89738934-89738956 CTTTTGAGGTTCCCTCAGTGGGG No data
1056807318_1056807333 28 Left 1056807318 9:89738919-89738941 CCCTACTTGGGCCTCCTTTTGAG No data
Right 1056807333 9:89738970-89738992 TGAGCTGCAGGGTCTCACGGAGG No data
1056807318_1056807322 -10 Left 1056807318 9:89738919-89738941 CCCTACTTGGGCCTCCTTTTGAG No data
Right 1056807322 9:89738932-89738954 TCCTTTTGAGGTTCCCTCAGTGG No data
1056807318_1056807328 16 Left 1056807318 9:89738919-89738941 CCCTACTTGGGCCTCCTTTTGAG No data
Right 1056807328 9:89738958-89738980 GCATCCTATGCCTGAGCTGCAGG No data
1056807318_1056807324 -9 Left 1056807318 9:89738919-89738941 CCCTACTTGGGCCTCCTTTTGAG No data
Right 1056807324 9:89738933-89738955 CCTTTTGAGGTTCCCTCAGTGGG No data
1056807318_1056807331 25 Left 1056807318 9:89738919-89738941 CCCTACTTGGGCCTCCTTTTGAG No data
Right 1056807331 9:89738967-89738989 GCCTGAGCTGCAGGGTCTCACGG No data
1056807318_1056807329 17 Left 1056807318 9:89738919-89738941 CCCTACTTGGGCCTCCTTTTGAG No data
Right 1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056807318 Original CRISPR CTCAAAAGGAGGCCCAAGTA GGG (reversed) Intergenic
No off target data available for this crispr