ID: 1056807319

View in Genome Browser
Species Human (GRCh38)
Location 9:89738920-89738942
Sequence CCTCAAAAGGAGGCCCAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056807319_1056807331 24 Left 1056807319 9:89738920-89738942 CCTACTTGGGCCTCCTTTTGAGG No data
Right 1056807331 9:89738967-89738989 GCCTGAGCTGCAGGGTCTCACGG No data
1056807319_1056807324 -10 Left 1056807319 9:89738920-89738942 CCTACTTGGGCCTCCTTTTGAGG No data
Right 1056807324 9:89738933-89738955 CCTTTTGAGGTTCCCTCAGTGGG No data
1056807319_1056807333 27 Left 1056807319 9:89738920-89738942 CCTACTTGGGCCTCCTTTTGAGG No data
Right 1056807333 9:89738970-89738992 TGAGCTGCAGGGTCTCACGGAGG No data
1056807319_1056807329 16 Left 1056807319 9:89738920-89738942 CCTACTTGGGCCTCCTTTTGAGG No data
Right 1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG No data
1056807319_1056807328 15 Left 1056807319 9:89738920-89738942 CCTACTTGGGCCTCCTTTTGAGG No data
Right 1056807328 9:89738958-89738980 GCATCCTATGCCTGAGCTGCAGG No data
1056807319_1056807325 -9 Left 1056807319 9:89738920-89738942 CCTACTTGGGCCTCCTTTTGAGG No data
Right 1056807325 9:89738934-89738956 CTTTTGAGGTTCCCTCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056807319 Original CRISPR CCTCAAAAGGAGGCCCAAGT AGG (reversed) Intergenic
No off target data available for this crispr