ID: 1056807327

View in Genome Browser
Species Human (GRCh38)
Location 9:89738946-89738968
Sequence GCATAGGATGCTCCCCACTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056807327_1056807331 -2 Left 1056807327 9:89738946-89738968 CCTCAGTGGGGAGCATCCTATGC No data
Right 1056807331 9:89738967-89738989 GCCTGAGCTGCAGGGTCTCACGG No data
1056807327_1056807335 26 Left 1056807327 9:89738946-89738968 CCTCAGTGGGGAGCATCCTATGC No data
Right 1056807335 9:89738995-89739017 CTGCCTCCACTTCACATACCTGG No data
1056807327_1056807333 1 Left 1056807327 9:89738946-89738968 CCTCAGTGGGGAGCATCCTATGC No data
Right 1056807333 9:89738970-89738992 TGAGCTGCAGGGTCTCACGGAGG No data
1056807327_1056807329 -10 Left 1056807327 9:89738946-89738968 CCTCAGTGGGGAGCATCCTATGC No data
Right 1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056807327 Original CRISPR GCATAGGATGCTCCCCACTG AGG (reversed) Intergenic
No off target data available for this crispr