ID: 1056807329

View in Genome Browser
Species Human (GRCh38)
Location 9:89738959-89738981
Sequence CATCCTATGCCTGAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056807321_1056807329 6 Left 1056807321 9:89738930-89738952 CCTCCTTTTGAGGTTCCCTCAGT No data
Right 1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG No data
1056807317_1056807329 18 Left 1056807317 9:89738918-89738940 CCCCTACTTGGGCCTCCTTTTGA No data
Right 1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG No data
1056807319_1056807329 16 Left 1056807319 9:89738920-89738942 CCTACTTGGGCCTCCTTTTGAGG No data
Right 1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG No data
1056807323_1056807329 3 Left 1056807323 9:89738933-89738955 CCTTTTGAGGTTCCCTCAGTGGG No data
Right 1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG No data
1056807326_1056807329 -9 Left 1056807326 9:89738945-89738967 CCCTCAGTGGGGAGCATCCTATG No data
Right 1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG No data
1056807318_1056807329 17 Left 1056807318 9:89738919-89738941 CCCTACTTGGGCCTCCTTTTGAG No data
Right 1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG No data
1056807327_1056807329 -10 Left 1056807327 9:89738946-89738968 CCTCAGTGGGGAGCATCCTATGC No data
Right 1056807329 9:89738959-89738981 CATCCTATGCCTGAGCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056807329 Original CRISPR CATCCTATGCCTGAGCTGCA GGG Intergenic
No off target data available for this crispr