ID: 1056809243

View in Genome Browser
Species Human (GRCh38)
Location 9:89751465-89751487
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056809239_1056809243 10 Left 1056809239 9:89751432-89751454 CCTTCTGAAATGCAGTCACAAGC No data
Right 1056809243 9:89751465-89751487 CAAGAGAGCAGAGACCCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056809243 Original CRISPR CAAGAGAGCAGAGACCCCTT AGG Intergenic
No off target data available for this crispr