ID: 1056810524

View in Genome Browser
Species Human (GRCh38)
Location 9:89760470-89760492
Sequence AGGCTGGCAGGAGACAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056810524_1056810533 15 Left 1056810524 9:89760470-89760492 CCTGGCCTGTCTCCTGCCAGCCT No data
Right 1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG No data
1056810524_1056810532 5 Left 1056810524 9:89760470-89760492 CCTGGCCTGTCTCCTGCCAGCCT No data
Right 1056810532 9:89760498-89760520 CCATCAGCATTCCCACCCGCGGG No data
1056810524_1056810530 4 Left 1056810524 9:89760470-89760492 CCTGGCCTGTCTCCTGCCAGCCT No data
Right 1056810530 9:89760497-89760519 TCCATCAGCATTCCCACCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056810524 Original CRISPR AGGCTGGCAGGAGACAGGCC AGG (reversed) Intergenic
No off target data available for this crispr