ID: 1056810525

View in Genome Browser
Species Human (GRCh38)
Location 9:89760475-89760497
Sequence AGGTGAGGCTGGCAGGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056810525_1056810533 10 Left 1056810525 9:89760475-89760497 CCTGTCTCCTGCCAGCCTCACCT No data
Right 1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG No data
1056810525_1056810532 0 Left 1056810525 9:89760475-89760497 CCTGTCTCCTGCCAGCCTCACCT No data
Right 1056810532 9:89760498-89760520 CCATCAGCATTCCCACCCGCGGG No data
1056810525_1056810530 -1 Left 1056810525 9:89760475-89760497 CCTGTCTCCTGCCAGCCTCACCT No data
Right 1056810530 9:89760497-89760519 TCCATCAGCATTCCCACCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056810525 Original CRISPR AGGTGAGGCTGGCAGGAGAC AGG (reversed) Intergenic
No off target data available for this crispr