ID: 1056810526

View in Genome Browser
Species Human (GRCh38)
Location 9:89760482-89760504
Sequence CTGATGGAGGTGAGGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056810526_1056810532 -7 Left 1056810526 9:89760482-89760504 CCTGCCAGCCTCACCTCCATCAG No data
Right 1056810532 9:89760498-89760520 CCATCAGCATTCCCACCCGCGGG No data
1056810526_1056810530 -8 Left 1056810526 9:89760482-89760504 CCTGCCAGCCTCACCTCCATCAG No data
Right 1056810530 9:89760497-89760519 TCCATCAGCATTCCCACCCGCGG No data
1056810526_1056810533 3 Left 1056810526 9:89760482-89760504 CCTGCCAGCCTCACCTCCATCAG No data
Right 1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG No data
1056810526_1056810540 26 Left 1056810526 9:89760482-89760504 CCTGCCAGCCTCACCTCCATCAG No data
Right 1056810540 9:89760531-89760553 CCCCATTCCTGCTCCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056810526 Original CRISPR CTGATGGAGGTGAGGCTGGC AGG (reversed) Intergenic
No off target data available for this crispr