ID: 1056810527

View in Genome Browser
Species Human (GRCh38)
Location 9:89760486-89760508
Sequence AATGCTGATGGAGGTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056810527_1056810533 -1 Left 1056810527 9:89760486-89760508 CCAGCCTCACCTCCATCAGCATT No data
Right 1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG No data
1056810527_1056810540 22 Left 1056810527 9:89760486-89760508 CCAGCCTCACCTCCATCAGCATT No data
Right 1056810540 9:89760531-89760553 CCCCATTCCTGCTCCTGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056810527 Original CRISPR AATGCTGATGGAGGTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr