ID: 1056810528

View in Genome Browser
Species Human (GRCh38)
Location 9:89760490-89760512
Sequence TGGGAATGCTGATGGAGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056810528_1056810540 18 Left 1056810528 9:89760490-89760512 CCTCACCTCCATCAGCATTCCCA No data
Right 1056810540 9:89760531-89760553 CCCCATTCCTGCTCCTGCCCTGG No data
1056810528_1056810533 -5 Left 1056810528 9:89760490-89760512 CCTCACCTCCATCAGCATTCCCA No data
Right 1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056810528 Original CRISPR TGGGAATGCTGATGGAGGTG AGG (reversed) Intergenic
No off target data available for this crispr