ID: 1056810533

View in Genome Browser
Species Human (GRCh38)
Location 9:89760508-89760530
Sequence TCCCACCCGCGGGTGTCCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056810524_1056810533 15 Left 1056810524 9:89760470-89760492 CCTGGCCTGTCTCCTGCCAGCCT No data
Right 1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG No data
1056810526_1056810533 3 Left 1056810526 9:89760482-89760504 CCTGCCAGCCTCACCTCCATCAG No data
Right 1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG No data
1056810527_1056810533 -1 Left 1056810527 9:89760486-89760508 CCAGCCTCACCTCCATCAGCATT No data
Right 1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG No data
1056810528_1056810533 -5 Left 1056810528 9:89760490-89760512 CCTCACCTCCATCAGCATTCCCA No data
Right 1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG No data
1056810525_1056810533 10 Left 1056810525 9:89760475-89760497 CCTGTCTCCTGCCAGCCTCACCT No data
Right 1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG No data
1056810529_1056810533 -10 Left 1056810529 9:89760495-89760517 CCTCCATCAGCATTCCCACCCGC No data
Right 1056810533 9:89760508-89760530 TCCCACCCGCGGGTGTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056810533 Original CRISPR TCCCACCCGCGGGTGTCCAT AGG Intergenic
No off target data available for this crispr