ID: 1056811479

View in Genome Browser
Species Human (GRCh38)
Location 9:89768425-89768447
Sequence TTTAACTGTACTTTGTCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056811479_1056811481 -2 Left 1056811479 9:89768425-89768447 CCTGAAGACAAAGTACAGTTAAA No data
Right 1056811481 9:89768446-89768468 AAGCAATGGCTATTGAGAAGTGG No data
1056811479_1056811484 27 Left 1056811479 9:89768425-89768447 CCTGAAGACAAAGTACAGTTAAA No data
Right 1056811484 9:89768475-89768497 GGTCCAATCAGAGCAAAAGCAGG No data
1056811479_1056811482 3 Left 1056811479 9:89768425-89768447 CCTGAAGACAAAGTACAGTTAAA No data
Right 1056811482 9:89768451-89768473 ATGGCTATTGAGAAGTGGAGAGG No data
1056811479_1056811483 6 Left 1056811479 9:89768425-89768447 CCTGAAGACAAAGTACAGTTAAA No data
Right 1056811483 9:89768454-89768476 GCTATTGAGAAGTGGAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056811479 Original CRISPR TTTAACTGTACTTTGTCTTC AGG (reversed) Intergenic
No off target data available for this crispr