ID: 1056811484

View in Genome Browser
Species Human (GRCh38)
Location 9:89768475-89768497
Sequence GGTCCAATCAGAGCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056811479_1056811484 27 Left 1056811479 9:89768425-89768447 CCTGAAGACAAAGTACAGTTAAA No data
Right 1056811484 9:89768475-89768497 GGTCCAATCAGAGCAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056811484 Original CRISPR GGTCCAATCAGAGCAAAAGC AGG Intergenic
No off target data available for this crispr