ID: 1056811835

View in Genome Browser
Species Human (GRCh38)
Location 9:89771133-89771155
Sequence TTCTCACAGCCACCCAGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056811835_1056811840 7 Left 1056811835 9:89771133-89771155 CCTCTCCTGGGTGGCTGTGAGAA No data
Right 1056811840 9:89771163-89771185 AGTGAGGTGTGTCAGATACCTGG No data
1056811835_1056811842 20 Left 1056811835 9:89771133-89771155 CCTCTCCTGGGTGGCTGTGAGAA No data
Right 1056811842 9:89771176-89771198 AGATACCTGGCAAGGTGCCTAGG No data
1056811835_1056811841 12 Left 1056811835 9:89771133-89771155 CCTCTCCTGGGTGGCTGTGAGAA No data
Right 1056811841 9:89771168-89771190 GGTGTGTCAGATACCTGGCAAGG No data
1056811835_1056811839 -9 Left 1056811835 9:89771133-89771155 CCTCTCCTGGGTGGCTGTGAGAA No data
Right 1056811839 9:89771147-89771169 CTGTGAGAATAAAGGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056811835 Original CRISPR TTCTCACAGCCACCCAGGAG AGG (reversed) Intergenic
No off target data available for this crispr