ID: 1056815288

View in Genome Browser
Species Human (GRCh38)
Location 9:89796679-89796701
Sequence GAGGAGGCCAAGTGCTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056815284_1056815288 -3 Left 1056815284 9:89796659-89796681 CCTTGAACTGGTGCTGCTGTGAG No data
Right 1056815288 9:89796679-89796701 GAGGAGGCCAAGTGCTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056815288 Original CRISPR GAGGAGGCCAAGTGCTCACA GGG Intergenic
No off target data available for this crispr