ID: 1056815402

View in Genome Browser
Species Human (GRCh38)
Location 9:89797272-89797294
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056815396_1056815402 23 Left 1056815396 9:89797226-89797248 CCAGGGTGGACAGTGGCGTGAAT No data
Right 1056815402 9:89797272-89797294 TATTGTTTTCAGAGGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056815402 Original CRISPR TATTGTTTTCAGAGGGAGAC AGG Intergenic
No off target data available for this crispr