ID: 1056817485

View in Genome Browser
Species Human (GRCh38)
Location 9:89812109-89812131
Sequence CCCCATGCCCACCTGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056817470_1056817485 30 Left 1056817470 9:89812056-89812078 CCTCCAGGAGCCCAGCTGTAGGG No data
Right 1056817485 9:89812109-89812131 CCCCATGCCCACCTGCACCCAGG No data
1056817477_1056817485 20 Left 1056817477 9:89812066-89812088 CCCAGCTGTAGGGGGGAATGGAG No data
Right 1056817485 9:89812109-89812131 CCCCATGCCCACCTGCACCCAGG No data
1056817474_1056817485 27 Left 1056817474 9:89812059-89812081 CCAGGAGCCCAGCTGTAGGGGGG No data
Right 1056817485 9:89812109-89812131 CCCCATGCCCACCTGCACCCAGG No data
1056817478_1056817485 19 Left 1056817478 9:89812067-89812089 CCAGCTGTAGGGGGGAATGGAGG No data
Right 1056817485 9:89812109-89812131 CCCCATGCCCACCTGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056817485 Original CRISPR CCCCATGCCCACCTGCACCC AGG Intergenic
No off target data available for this crispr