ID: 1056818601

View in Genome Browser
Species Human (GRCh38)
Location 9:89820316-89820338
Sequence TCATAGCTAAATATCTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056818601_1056818607 28 Left 1056818601 9:89820316-89820338 CCACCCAAGATATTTAGCTATGA No data
Right 1056818607 9:89820367-89820389 GAGTGTGTATGTATGCAGGCAGG No data
1056818601_1056818606 24 Left 1056818601 9:89820316-89820338 CCACCCAAGATATTTAGCTATGA No data
Right 1056818606 9:89820363-89820385 ATGTGAGTGTGTATGTATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056818601 Original CRISPR TCATAGCTAAATATCTTGGG TGG (reversed) Intergenic
No off target data available for this crispr