ID: 1056820464

View in Genome Browser
Species Human (GRCh38)
Location 9:89838127-89838149
Sequence GCCTGTGTGGTGCCCTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056820459_1056820464 6 Left 1056820459 9:89838098-89838120 CCCCTGTCACTGAAGTTCCATGT No data
Right 1056820464 9:89838127-89838149 GCCTGTGTGGTGCCCTCCCCTGG No data
1056820458_1056820464 20 Left 1056820458 9:89838084-89838106 CCTCACTGACAGCTCCCCTGTCA No data
Right 1056820464 9:89838127-89838149 GCCTGTGTGGTGCCCTCCCCTGG No data
1056820461_1056820464 4 Left 1056820461 9:89838100-89838122 CCTGTCACTGAAGTTCCATGTAT No data
Right 1056820464 9:89838127-89838149 GCCTGTGTGGTGCCCTCCCCTGG No data
1056820457_1056820464 21 Left 1056820457 9:89838083-89838105 CCCTCACTGACAGCTCCCCTGTC No data
Right 1056820464 9:89838127-89838149 GCCTGTGTGGTGCCCTCCCCTGG No data
1056820460_1056820464 5 Left 1056820460 9:89838099-89838121 CCCTGTCACTGAAGTTCCATGTA No data
Right 1056820464 9:89838127-89838149 GCCTGTGTGGTGCCCTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056820464 Original CRISPR GCCTGTGTGGTGCCCTCCCC TGG Intergenic
No off target data available for this crispr