ID: 1056824011

View in Genome Browser
Species Human (GRCh38)
Location 9:89864366-89864388
Sequence GGCTTGCAGAGTTGCTGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056824007_1056824011 -4 Left 1056824007 9:89864347-89864369 CCTCAGCCAGAAGTACCTGGGCT No data
Right 1056824011 9:89864366-89864388 GGCTTGCAGAGTTGCTGGACCGG No data
1056824004_1056824011 1 Left 1056824004 9:89864342-89864364 CCTCACCTCAGCCAGAAGTACCT No data
Right 1056824011 9:89864366-89864388 GGCTTGCAGAGTTGCTGGACCGG No data
1056824008_1056824011 -10 Left 1056824008 9:89864353-89864375 CCAGAAGTACCTGGGCTTGCAGA No data
Right 1056824011 9:89864366-89864388 GGCTTGCAGAGTTGCTGGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056824011 Original CRISPR GGCTTGCAGAGTTGCTGGAC CGG Intergenic