ID: 1056824647

View in Genome Browser
Species Human (GRCh38)
Location 9:89868493-89868515
Sequence GTGCATCCCCGCCCGCACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056824646_1056824647 12 Left 1056824646 9:89868458-89868480 CCTTAGGAAATGCAGGGGGAGGT No data
Right 1056824647 9:89868493-89868515 GTGCATCCCCGCCCGCACAGTGG No data
1056824644_1056824647 13 Left 1056824644 9:89868457-89868479 CCCTTAGGAAATGCAGGGGGAGG No data
Right 1056824647 9:89868493-89868515 GTGCATCCCCGCCCGCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056824647 Original CRISPR GTGCATCCCCGCCCGCACAG TGG Intergenic
No off target data available for this crispr