ID: 1056827491

View in Genome Browser
Species Human (GRCh38)
Location 9:89886730-89886752
Sequence AGGTATAAACAGAGGCATCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056827488_1056827491 -8 Left 1056827488 9:89886715-89886737 CCTGTGGACTAGCCAAGGTATAA No data
Right 1056827491 9:89886730-89886752 AGGTATAAACAGAGGCATCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056827491 Original CRISPR AGGTATAAACAGAGGCATCG AGG Intergenic
No off target data available for this crispr