ID: 1056827595

View in Genome Browser
Species Human (GRCh38)
Location 9:89887518-89887540
Sequence GGCCTTGGATGCTAGCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056827595_1056827601 12 Left 1056827595 9:89887518-89887540 CCTCTGGGCTAGCATCCAAGGCC No data
Right 1056827601 9:89887553-89887575 CTGAATGTCAACACCACCCAGGG No data
1056827595_1056827600 11 Left 1056827595 9:89887518-89887540 CCTCTGGGCTAGCATCCAAGGCC No data
Right 1056827600 9:89887552-89887574 CCTGAATGTCAACACCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056827595 Original CRISPR GGCCTTGGATGCTAGCCCAG AGG (reversed) Intergenic