ID: 1056827595 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:89887518-89887540 |
| Sequence | GGCCTTGGATGCTAGCCCAG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1056827595_1056827601 | 12 | Left | 1056827595 | 9:89887518-89887540 | CCTCTGGGCTAGCATCCAAGGCC | No data | ||
| Right | 1056827601 | 9:89887553-89887575 | CTGAATGTCAACACCACCCAGGG | No data | ||||
| 1056827595_1056827600 | 11 | Left | 1056827595 | 9:89887518-89887540 | CCTCTGGGCTAGCATCCAAGGCC | No data | ||
| Right | 1056827600 | 9:89887552-89887574 | CCTGAATGTCAACACCACCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1056827595 | Original CRISPR | GGCCTTGGATGCTAGCCCAG AGG (reversed) | Intergenic | ||