ID: 1056829862

View in Genome Browser
Species Human (GRCh38)
Location 9:89907070-89907092
Sequence GATGCTGGTGACCCACAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056829862_1056829868 12 Left 1056829862 9:89907070-89907092 CCCATCTGTGGGTCACCAGCATC No data
Right 1056829868 9:89907105-89907127 TAGATAAAACCACAAAGATGGGG 0: 5113
1: 2106
2: 955
3: 851
4: 795
1056829862_1056829866 10 Left 1056829862 9:89907070-89907092 CCCATCTGTGGGTCACCAGCATC No data
Right 1056829866 9:89907103-89907125 GATAGATAAAACCACAAAGATGG 0: 59
1: 2451
2: 4246
3: 1047
4: 712
1056829862_1056829867 11 Left 1056829862 9:89907070-89907092 CCCATCTGTGGGTCACCAGCATC No data
Right 1056829867 9:89907104-89907126 ATAGATAAAACCACAAAGATGGG 0: 90
1: 5331
2: 1933
3: 583
4: 705

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056829862 Original CRISPR GATGCTGGTGACCCACAGAT GGG (reversed) Intergenic
No off target data available for this crispr