ID: 1056832055

View in Genome Browser
Species Human (GRCh38)
Location 9:89925049-89925071
Sequence TGGTGCCTTCACGGGGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056832055_1056832062 -4 Left 1056832055 9:89925049-89925071 CCCCACTCCCCGTGAAGGCACCA No data
Right 1056832062 9:89925068-89925090 ACCAGGACTCTCTCTGCCCAAGG No data
1056832055_1056832068 26 Left 1056832055 9:89925049-89925071 CCCCACTCCCCGTGAAGGCACCA No data
Right 1056832068 9:89925098-89925120 CCTACCTTCTGTTAGTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056832055 Original CRISPR TGGTGCCTTCACGGGGAGTG GGG (reversed) Intergenic
No off target data available for this crispr