ID: 1056832062

View in Genome Browser
Species Human (GRCh38)
Location 9:89925068-89925090
Sequence ACCAGGACTCTCTCTGCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056832055_1056832062 -4 Left 1056832055 9:89925049-89925071 CCCCACTCCCCGTGAAGGCACCA No data
Right 1056832062 9:89925068-89925090 ACCAGGACTCTCTCTGCCCAAGG No data
1056832048_1056832062 27 Left 1056832048 9:89925018-89925040 CCAGAAATCCAAGATCCAGGTGT No data
Right 1056832062 9:89925068-89925090 ACCAGGACTCTCTCTGCCCAAGG No data
1056832051_1056832062 19 Left 1056832051 9:89925026-89925048 CCAAGATCCAGGTGTTGGCAGGG No data
Right 1056832062 9:89925068-89925090 ACCAGGACTCTCTCTGCCCAAGG No data
1056832056_1056832062 -5 Left 1056832056 9:89925050-89925072 CCCACTCCCCGTGAAGGCACCAG No data
Right 1056832062 9:89925068-89925090 ACCAGGACTCTCTCTGCCCAAGG No data
1056832057_1056832062 -6 Left 1056832057 9:89925051-89925073 CCACTCCCCGTGAAGGCACCAGG No data
Right 1056832062 9:89925068-89925090 ACCAGGACTCTCTCTGCCCAAGG No data
1056832053_1056832062 12 Left 1056832053 9:89925033-89925055 CCAGGTGTTGGCAGGGCCCCACT No data
Right 1056832062 9:89925068-89925090 ACCAGGACTCTCTCTGCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056832062 Original CRISPR ACCAGGACTCTCTCTGCCCA AGG Intergenic
No off target data available for this crispr