ID: 1056832068

View in Genome Browser
Species Human (GRCh38)
Location 9:89925098-89925120
Sequence CCTACCTTCTGTTAGTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056832057_1056832068 24 Left 1056832057 9:89925051-89925073 CCACTCCCCGTGAAGGCACCAGG No data
Right 1056832068 9:89925098-89925120 CCTACCTTCTGTTAGTTCCTTGG No data
1056832060_1056832068 18 Left 1056832060 9:89925057-89925079 CCCGTGAAGGCACCAGGACTCTC No data
Right 1056832068 9:89925098-89925120 CCTACCTTCTGTTAGTTCCTTGG No data
1056832063_1056832068 6 Left 1056832063 9:89925069-89925091 CCAGGACTCTCTCTGCCCAAGGC No data
Right 1056832068 9:89925098-89925120 CCTACCTTCTGTTAGTTCCTTGG No data
1056832064_1056832068 -9 Left 1056832064 9:89925084-89925106 CCCAAGGCCTCTCTCCTACCTTC No data
Right 1056832068 9:89925098-89925120 CCTACCTTCTGTTAGTTCCTTGG No data
1056832055_1056832068 26 Left 1056832055 9:89925049-89925071 CCCCACTCCCCGTGAAGGCACCA No data
Right 1056832068 9:89925098-89925120 CCTACCTTCTGTTAGTTCCTTGG No data
1056832061_1056832068 17 Left 1056832061 9:89925058-89925080 CCGTGAAGGCACCAGGACTCTCT No data
Right 1056832068 9:89925098-89925120 CCTACCTTCTGTTAGTTCCTTGG No data
1056832065_1056832068 -10 Left 1056832065 9:89925085-89925107 CCAAGGCCTCTCTCCTACCTTCT No data
Right 1056832068 9:89925098-89925120 CCTACCTTCTGTTAGTTCCTTGG No data
1056832059_1056832068 19 Left 1056832059 9:89925056-89925078 CCCCGTGAAGGCACCAGGACTCT No data
Right 1056832068 9:89925098-89925120 CCTACCTTCTGTTAGTTCCTTGG No data
1056832056_1056832068 25 Left 1056832056 9:89925050-89925072 CCCACTCCCCGTGAAGGCACCAG No data
Right 1056832068 9:89925098-89925120 CCTACCTTCTGTTAGTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056832068 Original CRISPR CCTACCTTCTGTTAGTTCCT TGG Intergenic
No off target data available for this crispr