ID: 1056832335

View in Genome Browser
Species Human (GRCh38)
Location 9:89927393-89927415
Sequence ATTGAGAACACCAAACAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056832335_1056832345 29 Left 1056832335 9:89927393-89927415 CCCTCCTGTTTGGTGTTCTCAAT No data
Right 1056832345 9:89927445-89927467 GAGGACAGACAACATTAGTCAGG No data
1056832335_1056832340 10 Left 1056832335 9:89927393-89927415 CCCTCCTGTTTGGTGTTCTCAAT No data
Right 1056832340 9:89927426-89927448 TCTGACTGTCCTCCCCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056832335 Original CRISPR ATTGAGAACACCAAACAGGA GGG (reversed) Intergenic
No off target data available for this crispr