ID: 1056832983

View in Genome Browser
Species Human (GRCh38)
Location 9:89931533-89931555
Sequence TCCTCGGAGGAGGGTCGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056832983_1056832992 26 Left 1056832983 9:89931533-89931555 CCTGCACGACCCTCCTCCGAGGA No data
Right 1056832992 9:89931582-89931604 AATTCAAATTTTGCCTACGTGGG No data
1056832983_1056832989 1 Left 1056832983 9:89931533-89931555 CCTGCACGACCCTCCTCCGAGGA No data
Right 1056832989 9:89931557-89931579 AGGCAGAAAGACCACAGTGCAGG No data
1056832983_1056832993 29 Left 1056832983 9:89931533-89931555 CCTGCACGACCCTCCTCCGAGGA No data
Right 1056832993 9:89931585-89931607 TCAAATTTTGCCTACGTGGGAGG No data
1056832983_1056832994 30 Left 1056832983 9:89931533-89931555 CCTGCACGACCCTCCTCCGAGGA No data
Right 1056832994 9:89931586-89931608 CAAATTTTGCCTACGTGGGAGGG No data
1056832983_1056832991 25 Left 1056832983 9:89931533-89931555 CCTGCACGACCCTCCTCCGAGGA No data
Right 1056832991 9:89931581-89931603 AAATTCAAATTTTGCCTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056832983 Original CRISPR TCCTCGGAGGAGGGTCGTGC AGG (reversed) Intergenic