ID: 1056833087

View in Genome Browser
Species Human (GRCh38)
Location 9:89932215-89932237
Sequence CAACAAAGACTTCTGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056833087_1056833089 -7 Left 1056833087 9:89932215-89932237 CCATGCTGCAGAAGTCTTTGTTG No data
Right 1056833089 9:89932231-89932253 TTTGTTGACGCAGGATCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056833087 Original CRISPR CAACAAAGACTTCTGCAGCA TGG (reversed) Intergenic
No off target data available for this crispr