ID: 1056835385

View in Genome Browser
Species Human (GRCh38)
Location 9:89951069-89951091
Sequence CTCACAGGTGAGCCTCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056835385_1056835388 -6 Left 1056835385 9:89951069-89951091 CCTGTAAGAGGCTCACCTGTGAG No data
Right 1056835388 9:89951086-89951108 TGTGAGAAAACTGAGGATGCAGG No data
1056835385_1056835391 9 Left 1056835385 9:89951069-89951091 CCTGTAAGAGGCTCACCTGTGAG No data
Right 1056835391 9:89951101-89951123 GATGCAGGACCAGGAAGGTGAGG No data
1056835385_1056835389 0 Left 1056835385 9:89951069-89951091 CCTGTAAGAGGCTCACCTGTGAG No data
Right 1056835389 9:89951092-89951114 AAAACTGAGGATGCAGGACCAGG No data
1056835385_1056835390 4 Left 1056835385 9:89951069-89951091 CCTGTAAGAGGCTCACCTGTGAG No data
Right 1056835390 9:89951096-89951118 CTGAGGATGCAGGACCAGGAAGG No data
1056835385_1056835393 21 Left 1056835385 9:89951069-89951091 CCTGTAAGAGGCTCACCTGTGAG No data
Right 1056835393 9:89951113-89951135 GGAAGGTGAGGATATCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056835385 Original CRISPR CTCACAGGTGAGCCTCTTAC AGG (reversed) Intergenic
No off target data available for this crispr