ID: 1056835390

View in Genome Browser
Species Human (GRCh38)
Location 9:89951096-89951118
Sequence CTGAGGATGCAGGACCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056835385_1056835390 4 Left 1056835385 9:89951069-89951091 CCTGTAAGAGGCTCACCTGTGAG No data
Right 1056835390 9:89951096-89951118 CTGAGGATGCAGGACCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056835390 Original CRISPR CTGAGGATGCAGGACCAGGA AGG Intergenic
No off target data available for this crispr