ID: 1056846249

View in Genome Browser
Species Human (GRCh38)
Location 9:90040471-90040493
Sequence GTCCTCCTTTAGGGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056846249_1056846256 -2 Left 1056846249 9:90040471-90040493 CCTCCTGGGCCCTAAAGGAGGAC No data
Right 1056846256 9:90040492-90040514 ACTGTGAGGAGGGTGCAACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056846249 Original CRISPR GTCCTCCTTTAGGGCCCAGG AGG (reversed) Intergenic
No off target data available for this crispr