ID: 1056846838 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 9:90045725-90045747 |
Sequence | CATTCTTTGCAGATGTTGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1056846835_1056846838 | -3 | Left | 1056846835 | 9:90045705-90045727 | CCTGGGTAGGAGCAGGATGCCAT | No data | ||
Right | 1056846838 | 9:90045725-90045747 | CATTCTTTGCAGATGTTGGATGG | No data | ||||
1056846832_1056846838 | 10 | Left | 1056846832 | 9:90045692-90045714 | CCAAGCTCACTCACCTGGGTAGG | No data | ||
Right | 1056846838 | 9:90045725-90045747 | CATTCTTTGCAGATGTTGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1056846838 | Original CRISPR | CATTCTTTGCAGATGTTGGA TGG | Intergenic | ||
No off target data available for this crispr |