ID: 1056846838

View in Genome Browser
Species Human (GRCh38)
Location 9:90045725-90045747
Sequence CATTCTTTGCAGATGTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056846835_1056846838 -3 Left 1056846835 9:90045705-90045727 CCTGGGTAGGAGCAGGATGCCAT No data
Right 1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG No data
1056846832_1056846838 10 Left 1056846832 9:90045692-90045714 CCAAGCTCACTCACCTGGGTAGG No data
Right 1056846838 9:90045725-90045747 CATTCTTTGCAGATGTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056846838 Original CRISPR CATTCTTTGCAGATGTTGGA TGG Intergenic
No off target data available for this crispr