ID: 1056847966

View in Genome Browser
Species Human (GRCh38)
Location 9:90056828-90056850
Sequence GGTCTCCACGGATGCTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056847961_1056847966 -8 Left 1056847961 9:90056813-90056835 CCACACCATCCTGGTGGTCTCCA No data
Right 1056847966 9:90056828-90056850 GGTCTCCACGGATGCTGGAGTGG No data
1056847960_1056847966 -7 Left 1056847960 9:90056812-90056834 CCCACACCATCCTGGTGGTCTCC No data
Right 1056847966 9:90056828-90056850 GGTCTCCACGGATGCTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056847966 Original CRISPR GGTCTCCACGGATGCTGGAG TGG Intergenic