ID: 1056856281

View in Genome Browser
Species Human (GRCh38)
Location 9:90132274-90132296
Sequence AACTGCCGGTGGAAGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056856281_1056856295 27 Left 1056856281 9:90132274-90132296 CCCTCATACTTCCACCGGCAGTT No data
Right 1056856295 9:90132324-90132346 TTGGAGATGGAGATCTAAGTGGG No data
1056856281_1056856294 26 Left 1056856281 9:90132274-90132296 CCCTCATACTTCCACCGGCAGTT No data
Right 1056856294 9:90132323-90132345 CTTGGAGATGGAGATCTAAGTGG No data
1056856281_1056856288 8 Left 1056856281 9:90132274-90132296 CCCTCATACTTCCACCGGCAGTT No data
Right 1056856288 9:90132305-90132327 TCATTTCCATCTCCAGCCCTTGG No data
1056856281_1056856290 14 Left 1056856281 9:90132274-90132296 CCCTCATACTTCCACCGGCAGTT No data
Right 1056856290 9:90132311-90132333 CCATCTCCAGCCCTTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056856281 Original CRISPR AACTGCCGGTGGAAGTATGA GGG (reversed) Intergenic
No off target data available for this crispr