ID: 1056856288

View in Genome Browser
Species Human (GRCh38)
Location 9:90132305-90132327
Sequence TCATTTCCATCTCCAGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056856282_1056856288 7 Left 1056856282 9:90132275-90132297 CCTCATACTTCCACCGGCAGTTC No data
Right 1056856288 9:90132305-90132327 TCATTTCCATCTCCAGCCCTTGG No data
1056856279_1056856288 20 Left 1056856279 9:90132262-90132284 CCAGCTCACATTCCCTCATACTT No data
Right 1056856288 9:90132305-90132327 TCATTTCCATCTCCAGCCCTTGG No data
1056856276_1056856288 30 Left 1056856276 9:90132252-90132274 CCCCTAGTCTCCAGCTCACATTC No data
Right 1056856288 9:90132305-90132327 TCATTTCCATCTCCAGCCCTTGG No data
1056856278_1056856288 28 Left 1056856278 9:90132254-90132276 CCTAGTCTCCAGCTCACATTCCC No data
Right 1056856288 9:90132305-90132327 TCATTTCCATCTCCAGCCCTTGG No data
1056856283_1056856288 -3 Left 1056856283 9:90132285-90132307 CCACCGGCAGTTCCCAGACCTCA No data
Right 1056856288 9:90132305-90132327 TCATTTCCATCTCCAGCCCTTGG No data
1056856281_1056856288 8 Left 1056856281 9:90132274-90132296 CCCTCATACTTCCACCGGCAGTT No data
Right 1056856288 9:90132305-90132327 TCATTTCCATCTCCAGCCCTTGG No data
1056856277_1056856288 29 Left 1056856277 9:90132253-90132275 CCCTAGTCTCCAGCTCACATTCC No data
Right 1056856288 9:90132305-90132327 TCATTTCCATCTCCAGCCCTTGG No data
1056856284_1056856288 -6 Left 1056856284 9:90132288-90132310 CCGGCAGTTCCCAGACCTCATTT No data
Right 1056856288 9:90132305-90132327 TCATTTCCATCTCCAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056856288 Original CRISPR TCATTTCCATCTCCAGCCCT TGG Intergenic
No off target data available for this crispr