ID: 1056856290

View in Genome Browser
Species Human (GRCh38)
Location 9:90132311-90132333
Sequence CCATCTCCAGCCCTTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056856282_1056856290 13 Left 1056856282 9:90132275-90132297 CCTCATACTTCCACCGGCAGTTC No data
Right 1056856290 9:90132311-90132333 CCATCTCCAGCCCTTGGAGATGG No data
1056856279_1056856290 26 Left 1056856279 9:90132262-90132284 CCAGCTCACATTCCCTCATACTT No data
Right 1056856290 9:90132311-90132333 CCATCTCCAGCCCTTGGAGATGG No data
1056856281_1056856290 14 Left 1056856281 9:90132274-90132296 CCCTCATACTTCCACCGGCAGTT No data
Right 1056856290 9:90132311-90132333 CCATCTCCAGCCCTTGGAGATGG No data
1056856286_1056856290 -10 Left 1056856286 9:90132298-90132320 CCAGACCTCATTTCCATCTCCAG No data
Right 1056856290 9:90132311-90132333 CCATCTCCAGCCCTTGGAGATGG No data
1056856285_1056856290 -9 Left 1056856285 9:90132297-90132319 CCCAGACCTCATTTCCATCTCCA No data
Right 1056856290 9:90132311-90132333 CCATCTCCAGCCCTTGGAGATGG No data
1056856284_1056856290 0 Left 1056856284 9:90132288-90132310 CCGGCAGTTCCCAGACCTCATTT No data
Right 1056856290 9:90132311-90132333 CCATCTCCAGCCCTTGGAGATGG No data
1056856283_1056856290 3 Left 1056856283 9:90132285-90132307 CCACCGGCAGTTCCCAGACCTCA No data
Right 1056856290 9:90132311-90132333 CCATCTCCAGCCCTTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056856290 Original CRISPR CCATCTCCAGCCCTTGGAGA TGG Intergenic
No off target data available for this crispr