ID: 1056865320

View in Genome Browser
Species Human (GRCh38)
Location 9:90223636-90223658
Sequence CTGCCGAGGGAGGGGTGGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056865320_1056865327 -2 Left 1056865320 9:90223636-90223658 CCATTCCACCCCTCCCTCGGCAG No data
Right 1056865327 9:90223657-90223679 AGCTCGTTTACGACCCAAAACGG No data
1056865320_1056865329 0 Left 1056865320 9:90223636-90223658 CCATTCCACCCCTCCCTCGGCAG No data
Right 1056865329 9:90223659-90223681 CTCGTTTACGACCCAAAACGGGG No data
1056865320_1056865332 27 Left 1056865320 9:90223636-90223658 CCATTCCACCCCTCCCTCGGCAG No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG No data
1056865320_1056865328 -1 Left 1056865320 9:90223636-90223658 CCATTCCACCCCTCCCTCGGCAG No data
Right 1056865328 9:90223658-90223680 GCTCGTTTACGACCCAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056865320 Original CRISPR CTGCCGAGGGAGGGGTGGAA TGG (reversed) Intergenic