ID: 1056865321

View in Genome Browser
Species Human (GRCh38)
Location 9:90223641-90223663
Sequence ACGAGCTGCCGAGGGAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056865321_1056865336 30 Left 1056865321 9:90223641-90223663 CCACCCCTCCCTCGGCAGCTCGT No data
Right 1056865336 9:90223694-90223716 CTGAGAGAGCAGCGGTATACTGG 0: 33
1: 31
2: 22
3: 17
4: 85
1056865321_1056865329 -5 Left 1056865321 9:90223641-90223663 CCACCCCTCCCTCGGCAGCTCGT No data
Right 1056865329 9:90223659-90223681 CTCGTTTACGACCCAAAACGGGG No data
1056865321_1056865328 -6 Left 1056865321 9:90223641-90223663 CCACCCCTCCCTCGGCAGCTCGT No data
Right 1056865328 9:90223658-90223680 GCTCGTTTACGACCCAAAACGGG No data
1056865321_1056865332 22 Left 1056865321 9:90223641-90223663 CCACCCCTCCCTCGGCAGCTCGT No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270
1056865321_1056865327 -7 Left 1056865321 9:90223641-90223663 CCACCCCTCCCTCGGCAGCTCGT No data
Right 1056865327 9:90223657-90223679 AGCTCGTTTACGACCCAAAACGG 0: 20
1: 17
2: 13
3: 8
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056865321 Original CRISPR ACGAGCTGCCGAGGGAGGGG TGG (reversed) Intergenic
No off target data available for this crispr