ID: 1056865322

View in Genome Browser
Species Human (GRCh38)
Location 9:90223644-90223666
Sequence TAAACGAGCTGCCGAGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056865322_1056865327 -10 Left 1056865322 9:90223644-90223666 CCCCTCCCTCGGCAGCTCGTTTA No data
Right 1056865327 9:90223657-90223679 AGCTCGTTTACGACCCAAAACGG No data
1056865322_1056865332 19 Left 1056865322 9:90223644-90223666 CCCCTCCCTCGGCAGCTCGTTTA No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG No data
1056865322_1056865336 27 Left 1056865322 9:90223644-90223666 CCCCTCCCTCGGCAGCTCGTTTA No data
Right 1056865336 9:90223694-90223716 CTGAGAGAGCAGCGGTATACTGG No data
1056865322_1056865329 -8 Left 1056865322 9:90223644-90223666 CCCCTCCCTCGGCAGCTCGTTTA No data
Right 1056865329 9:90223659-90223681 CTCGTTTACGACCCAAAACGGGG No data
1056865322_1056865328 -9 Left 1056865322 9:90223644-90223666 CCCCTCCCTCGGCAGCTCGTTTA No data
Right 1056865328 9:90223658-90223680 GCTCGTTTACGACCCAAAACGGG No data
1056865322_1056865337 28 Left 1056865322 9:90223644-90223666 CCCCTCCCTCGGCAGCTCGTTTA No data
Right 1056865337 9:90223695-90223717 TGAGAGAGCAGCGGTATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056865322 Original CRISPR TAAACGAGCTGCCGAGGGAG GGG (reversed) Intergenic