ID: 1056865323

View in Genome Browser
Species Human (GRCh38)
Location 9:90223645-90223667
Sequence GTAAACGAGCTGCCGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056865323_1056865329 -9 Left 1056865323 9:90223645-90223667 CCCTCCCTCGGCAGCTCGTTTAC No data
Right 1056865329 9:90223659-90223681 CTCGTTTACGACCCAAAACGGGG No data
1056865323_1056865337 27 Left 1056865323 9:90223645-90223667 CCCTCCCTCGGCAGCTCGTTTAC No data
Right 1056865337 9:90223695-90223717 TGAGAGAGCAGCGGTATACTGGG 0: 30
1: 33
2: 23
3: 21
4: 69
1056865323_1056865336 26 Left 1056865323 9:90223645-90223667 CCCTCCCTCGGCAGCTCGTTTAC No data
Right 1056865336 9:90223694-90223716 CTGAGAGAGCAGCGGTATACTGG 0: 33
1: 31
2: 22
3: 17
4: 85
1056865323_1056865328 -10 Left 1056865323 9:90223645-90223667 CCCTCCCTCGGCAGCTCGTTTAC No data
Right 1056865328 9:90223658-90223680 GCTCGTTTACGACCCAAAACGGG No data
1056865323_1056865332 18 Left 1056865323 9:90223645-90223667 CCCTCCCTCGGCAGCTCGTTTAC No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056865323 Original CRISPR GTAAACGAGCTGCCGAGGGA GGG (reversed) Intergenic
No off target data available for this crispr