ID: 1056865324

View in Genome Browser
Species Human (GRCh38)
Location 9:90223646-90223668
Sequence CGTAAACGAGCTGCCGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056865324_1056865332 17 Left 1056865324 9:90223646-90223668 CCTCCCTCGGCAGCTCGTTTACG No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270
1056865324_1056865336 25 Left 1056865324 9:90223646-90223668 CCTCCCTCGGCAGCTCGTTTACG No data
Right 1056865336 9:90223694-90223716 CTGAGAGAGCAGCGGTATACTGG 0: 33
1: 31
2: 22
3: 17
4: 85
1056865324_1056865329 -10 Left 1056865324 9:90223646-90223668 CCTCCCTCGGCAGCTCGTTTACG No data
Right 1056865329 9:90223659-90223681 CTCGTTTACGACCCAAAACGGGG No data
1056865324_1056865337 26 Left 1056865324 9:90223646-90223668 CCTCCCTCGGCAGCTCGTTTACG No data
Right 1056865337 9:90223695-90223717 TGAGAGAGCAGCGGTATACTGGG 0: 30
1: 33
2: 23
3: 21
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056865324 Original CRISPR CGTAAACGAGCTGCCGAGGG AGG (reversed) Intergenic
No off target data available for this crispr