ID: 1056865327

View in Genome Browser
Species Human (GRCh38)
Location 9:90223657-90223679
Sequence AGCTCGTTTACGACCCAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 20, 1: 17, 2: 13, 3: 8, 4: 36}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056865321_1056865327 -7 Left 1056865321 9:90223641-90223663 CCACCCCTCCCTCGGCAGCTCGT No data
Right 1056865327 9:90223657-90223679 AGCTCGTTTACGACCCAAAACGG 0: 20
1: 17
2: 13
3: 8
4: 36
1056865322_1056865327 -10 Left 1056865322 9:90223644-90223666 CCCCTCCCTCGGCAGCTCGTTTA No data
Right 1056865327 9:90223657-90223679 AGCTCGTTTACGACCCAAAACGG 0: 20
1: 17
2: 13
3: 8
4: 36
1056865320_1056865327 -2 Left 1056865320 9:90223636-90223658 CCATTCCACCCCTCCCTCGGCAG No data
Right 1056865327 9:90223657-90223679 AGCTCGTTTACGACCCAAAACGG 0: 20
1: 17
2: 13
3: 8
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056865327 Original CRISPR AGCTCGTTTACGACCCAAAA CGG Intergenic
904854585 1:33488354-33488376 GGCTCTTTTAAGATCCAAAATGG - Intronic
906987633 1:50702413-50702435 AGTTAATTTAGGACCCAAAAAGG + Intronic
911782669 1:101902447-101902469 AGCATGTTTGCCACCCAAAAGGG + Intronic
912970513 1:114277418-114277440 AGCTCAGTTACAACCCCAAAAGG + Intergenic
1064394990 10:14974535-14974557 AGCTGGTTTACGACCCAAAACGG - Intronic
1064396038 10:14982664-14982686 AGCTCGTCTACGACCCAAAACGG - Intronic
1064397737 10:14994851-14994873 AGCTCGTTTAGGACCCTAAACGG - Intergenic
1066354795 10:34672305-34672327 AGCTGGTTCACAACCCAAAAAGG + Intronic
1075226119 10:120630768-120630790 AGCTCTTTTCAGACCTAAAAAGG - Intergenic
1076104329 10:127808610-127808632 ATCTTGTTTAGGAACCAAAATGG - Intergenic
1077589491 11:3480587-3480609 AGCTCGTTTAAGACCCAAAACGG - Intergenic
1078967069 11:16358123-16358145 AGCTGATTTACTCCCCAAAAAGG + Intronic
1079747941 11:24156130-24156152 GGCTCCTTTAAGGCCCAAAAGGG + Intergenic
1084228215 11:67730828-67730850 AGCTCGTTTACCAACCAAAACGG - Intergenic
1084245212 11:67852361-67852383 AGCTCGTTTAAGACCCAAAACGG - Intergenic
1084261618 11:67982516-67982538 AGCTCGTTTACGACCCAAAACGG - Intergenic
1084807013 11:71586034-71586056 AGCTTGTTTATGACCCAAAATGG + Intronic
1084811025 11:71611597-71611619 AGCTTGTTTACGACCCAAAACGG + Intergenic
1084827476 11:71742217-71742239 AGCTCGTTTAAGACCCAAAACGG + Intergenic
1084844095 11:71886048-71886070 AGCTCGTTTACGACCCAAAAGGG + Intronic
1084846953 11:71908505-71908527 AGCTCGTTTACAACCCAAAACGG + Intronic
1085871658 11:80357444-80357466 AGCTCTTTAAAGACCAAAAAAGG + Intergenic
1092415781 12:8289493-8289515 AGTTCGTTTAAGACCCAAAACGG - Intergenic
1092432905 12:8423078-8423100 AGCTCGTTTATGACCTCAAACGG - Intergenic
1092435500 12:8443707-8443729 AGCTCGTTTAAGACCCAAAACGG - Intergenic
1096191471 12:49623011-49623033 AGCACGTGTACGCCCCACAAGGG + Intronic
1107544671 13:41424606-41424628 AGCTCGTTTACGACCCAAAACGG - Intergenic
1111144519 13:84163455-84163477 GGCTCTTTTAGGAACCAAAAGGG - Intergenic
1111491112 13:88976540-88976562 ACCTTATTTACGAACCAAAAAGG - Intergenic
1117038286 14:51748601-51748623 AGCTCATTGACGACCCAAAACGG + Intergenic
1134859702 16:17550172-17550194 AGCTAGTTTGAGTCCCAAAACGG - Intergenic
1138315151 16:56063672-56063694 AGAAGGTTTATGACCCAAAAAGG + Intergenic
1149628233 17:58095732-58095754 AGCTTGTTTTTGACCCAAAAGGG - Intergenic
1158917329 18:62147353-62147375 ATCTCATTTAGGACCTAAAAAGG - Intronic
928908314 2:36391703-36391725 ACCTGATTTACCACCCAAAAAGG - Intronic
932349418 2:71020414-71020436 AGCTCCTTTACGGCCCAAAACGG + Intergenic
938827938 2:135025231-135025253 AGCTCTTTTATGATTCAAAATGG + Intronic
940871699 2:158866199-158866221 AGCTCTTTTACGACCCAAAACGG + Intergenic
940873923 2:158882202-158882224 AGCTCATTTATGACTCAAAACGG + Intergenic
1174527759 20:51187491-51187513 AGCTGGTTAACGACCCAAGATGG + Intergenic
949882543 3:8673370-8673392 TGCTCGTTTACGATGCAAAACGG + Intronic
952742431 3:36747783-36747805 ATCCCCTTTACGACCCAAAGTGG + Intergenic
956596182 3:70970049-70970071 AGCGAGATTACCACCCAAAAAGG - Intronic
957076689 3:75608089-75608111 AGCTCGTTTATGACCCAAAACGG - Intergenic
961271774 3:125694875-125694897 AGCTCGTTTACGACCCAAAACGG + Intergenic
961274607 3:125717100-125717122 AGCTCGTTTACGACCCAAAACGG + Intergenic
961277529 3:125739732-125739754 AGCTCGTTTATGACCCTAAACGG + Intergenic
961876894 3:130029932-130029954 AGCTCGTTTACGACCCAAAACGG - Intergenic
961893326 3:130148106-130148128 AGCTCATTTAAGACCCAAAACGG - Intergenic
968989171 4:3897133-3897155 AGCTCGTTTGCGACACAAAACGG - Intergenic
969020143 4:4134383-4134405 AGCTCGTTTATGACCCAAAACGG - Intergenic
969024843 4:4164777-4164799 AGCTCGTTTGAGACGCAAAACGG - Intergenic
969025742 4:4170722-4170744 AGCTCGTTTACGACCCAAAACGG - Intergenic
969728972 4:8942386-8942408 AGCTCGTTTACGACCCAAAACGG + Intergenic
969733714 4:8973029-8973051 AGCTCGTTTACGACCCAAAACGG + Intergenic
969785146 4:9451920-9451942 AGCTCGTTTACGACCCAAAACGG + Intergenic
969793304 4:9507089-9507111 AGCTCGTTTACGACCCAAAACGG + Intergenic
969826190 4:9760464-9760486 AGCTCGTTTACGACCCAAAACGG + Intergenic
973026599 4:45281163-45281185 TAGTCGTTTACTACCCAAAAGGG - Intergenic
974476992 4:62395285-62395307 AGCTAGATTAAGACCCAGAAAGG + Intergenic
975226710 4:71880996-71881018 ATCTCATTTAGGAACCAAAAGGG + Intergenic
985887672 5:2692623-2692645 ATCTCATTTAGGAACCAAAATGG - Intergenic
986254410 5:6090173-6090195 AGCCCTTTTTAGACCCAAAAGGG + Intergenic
987157863 5:15109168-15109190 ATCTCATTTAGGAACCAAAAGGG - Intergenic
987371415 5:17196713-17196735 AGCTCCTGTAGGACCCAAATTGG + Intronic
994657951 5:102617462-102617484 TGCTCGGTTACAACACAAAATGG - Intergenic
1000023445 5:157338741-157338763 AGCTTGTTCTCTACCCAAAAGGG + Intronic
1002776616 6:333354-333376 ATCTCCTTCAAGACCCAAAAGGG + Intronic
1002844448 6:934584-934606 AGCTGGTTTACTACCCTACAAGG + Intergenic
1003787042 6:9498155-9498177 AGCTCTTATCAGACCCAAAAAGG + Intergenic
1020307556 7:6846418-6846440 AGCTCTTTTACGACCCAAAACGG - Intergenic
1020312014 7:6875237-6875259 AGCTCGTTTGCGACGCAAAACGG - Intergenic
1020323553 7:6957603-6957625 AGCTCGTTTAAGACTCAAAACGG - Intergenic
1031684809 7:124720471-124720493 AGCAAGTGTATGACCCAAAAGGG + Intergenic
1035927436 8:3743630-3743652 ACCTCATTTAGGAACCAAAAAGG - Intronic
1036262543 8:7251996-7252018 AGCTCGTTTACGACCCAAAACGG - Intergenic
1036304044 8:7587562-7587584 AGCTCGTTTACGACCCAAAACGG + Intergenic
1036314582 8:7710535-7710557 AGCTCGTTTACGACCCAAAACGG - Intergenic
1036354899 8:8035554-8035576 AGCTCGTTTACGACCCAAAACGG + Intergenic
1036372510 8:8173380-8173402 AGCTCGTTTAAGACCCAAAACGG + Intergenic
1036817113 8:11910485-11910507 AGCTCGTTTAAGACCCAAAATGG - Intergenic
1036817450 8:11912796-11912818 AGCTCGTTTATGGCCCAAAATGG - Intergenic
1036820415 8:11935376-11935398 AGCTCGTTTAAGACCCAAAATGG - Intergenic
1036833841 8:12041991-12042013 AGCTCGTTTACGACCCAAAAAGG - Intergenic
1036855686 8:12288556-12288578 AGCTCGTTTACGACCCAAAAAGG - Intergenic
1036878393 8:12492261-12492283 AGCTCGTTTAAGACCCAAAACGG - Intergenic
1036906478 8:12712069-12712091 AGCTCCTTTACAACCCCAAATGG - Intergenic
1038798622 8:30730184-30730206 AGCTCGTTTAAGACCCAAAACGG + Intergenic
1048388403 8:133935575-133935597 ATCTTGTTTAGGAACCAAAATGG + Intergenic
1056865327 9:90223657-90223679 AGCTCGTTTACGACCCAAAACGG + Intergenic
1056917683 9:90759230-90759252 AGCTCGTTTACGACCCAAAACGG - Intergenic
1187514577 X:19956625-19956647 ATCTCATTTTGGACCCAAAATGG + Intronic
1194400048 X:93431282-93431304 AGCTGGTTTAAGACCCAAAACGG + Intergenic
1201638424 Y:16151671-16151693 ACTTAGTTTAAGACCCAAAAGGG + Intergenic