ID: 1056865329

View in Genome Browser
Species Human (GRCh38)
Location 9:90223659-90223681
Sequence CTCGTTTACGACCCAAAACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056865322_1056865329 -8 Left 1056865322 9:90223644-90223666 CCCCTCCCTCGGCAGCTCGTTTA No data
Right 1056865329 9:90223659-90223681 CTCGTTTACGACCCAAAACGGGG No data
1056865320_1056865329 0 Left 1056865320 9:90223636-90223658 CCATTCCACCCCTCCCTCGGCAG No data
Right 1056865329 9:90223659-90223681 CTCGTTTACGACCCAAAACGGGG No data
1056865321_1056865329 -5 Left 1056865321 9:90223641-90223663 CCACCCCTCCCTCGGCAGCTCGT No data
Right 1056865329 9:90223659-90223681 CTCGTTTACGACCCAAAACGGGG No data
1056865324_1056865329 -10 Left 1056865324 9:90223646-90223668 CCTCCCTCGGCAGCTCGTTTACG No data
Right 1056865329 9:90223659-90223681 CTCGTTTACGACCCAAAACGGGG No data
1056865323_1056865329 -9 Left 1056865323 9:90223645-90223667 CCCTCCCTCGGCAGCTCGTTTAC No data
Right 1056865329 9:90223659-90223681 CTCGTTTACGACCCAAAACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056865329 Original CRISPR CTCGTTTACGACCCAAAACG GGG Intergenic
No off target data available for this crispr