ID: 1056865332

View in Genome Browser
Species Human (GRCh38)
Location 9:90223686-90223708
Sequence AAATGCCCCTGAGAGAGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 41, 1: 15, 2: 11, 3: 34, 4: 270}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056865324_1056865332 17 Left 1056865324 9:90223646-90223668 CCTCCCTCGGCAGCTCGTTTACG No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270
1056865320_1056865332 27 Left 1056865320 9:90223636-90223658 CCATTCCACCCCTCCCTCGGCAG No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270
1056865323_1056865332 18 Left 1056865323 9:90223645-90223667 CCCTCCCTCGGCAGCTCGTTTAC No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270
1056865326_1056865332 13 Left 1056865326 9:90223650-90223672 CCTCGGCAGCTCGTTTACGACCC No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270
1056865322_1056865332 19 Left 1056865322 9:90223644-90223666 CCCCTCCCTCGGCAGCTCGTTTA No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270
1056865321_1056865332 22 Left 1056865321 9:90223641-90223663 CCACCCCTCCCTCGGCAGCTCGT No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270
1056865330_1056865332 -7 Left 1056865330 9:90223670-90223692 CCCAAAACGGGGATACAAATGCC No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270
1056865325_1056865332 14 Left 1056865325 9:90223649-90223671 CCCTCGGCAGCTCGTTTACGACC No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270
1056865331_1056865332 -8 Left 1056865331 9:90223671-90223693 CCAAAACGGGGATACAAATGCCC No data
Right 1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG 0: 41
1: 15
2: 11
3: 34
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056865332 Original CRISPR AAATGCCCCTGAGAGAGCAG CGG Intergenic
900806358 1:4770511-4770533 ATAAGCCCCTGAGAAATCAGGGG + Intronic
901428632 1:9199083-9199105 AAATACCCCTGAGTCAGCACTGG + Intergenic
902296277 1:15469208-15469230 AGTTGCCCATGAGAGGGCAGAGG + Intronic
902986151 1:20155463-20155485 AAATGCCCCCGAGAGAGCAATGG + Intergenic
903416603 1:23187719-23187741 GAATGCACCTGAGGGAGCTGAGG + Intergenic
904597821 1:31657735-31657757 AAAGTCTCCTGGGAGAGCAGAGG - Intronic
909344787 1:74572472-74572494 AACTGACTCTGAGAGAGAAGAGG - Exonic
909555116 1:76944970-76944992 CAATGTCCCTAAGACAGCAGTGG - Intronic
910230204 1:84978119-84978141 AAATGCTCCTGAATGACCAGTGG + Intronic
911876312 1:103167874-103167896 AAATGACTCTGAGAGAGAACAGG + Intergenic
911973827 1:104466898-104466920 AAATGCCCTTAAGAGAACAATGG - Intergenic
913070027 1:115290254-115290276 AAAAGGCCCTGAGAGGGTAGGGG - Intronic
913707240 1:121437921-121437943 ATATGCTCCTGAGTGACCAGTGG + Intergenic
915604978 1:156944782-156944804 AACTCAGCCTGAGAGAGCAGGGG - Intronic
915705947 1:157843915-157843937 CACTGCACCAGAGAGAGCAGAGG + Intronic
916039210 1:160948025-160948047 AAATTCCCCTGAAAAAGAAGAGG + Exonic
916709697 1:167392727-167392749 AAATGACTTTGAGACAGCAGTGG + Intronic
916874968 1:168959477-168959499 AAATGGCCCTGAGAAGTCAGAGG + Intergenic
919118022 1:193305394-193305416 AAATAAACCTGAGAGATCAGTGG - Intergenic
921524663 1:216201739-216201761 AGATGACCCTGATAGAGCCGAGG + Intronic
921747420 1:218753786-218753808 AAATGCCCCTAAGAAGGCAATGG - Intergenic
922587792 1:226748812-226748834 AAATGACCAAGAGAGAACAGTGG + Intergenic
923430401 1:233914343-233914365 AAGTAACCCAGAGAGAGCAGTGG + Intronic
1063484161 10:6403460-6403482 ATATGCCCCAGAGATAGCAGAGG - Intergenic
1064394984 10:14974506-14974528 AAATGCCCCTGAGAGAGCAGCGG - Intronic
1064396032 10:14982635-14982657 AAATGCCCCTGAGAGAGCAGCGG - Intronic
1064397732 10:14994822-14994844 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1064690230 10:17909436-17909458 AAATTCTACTGAGAGAGCAGGGG - Intronic
1064742437 10:18447584-18447606 AAATGCTGCAGAGAGAGGAGTGG + Intronic
1065728258 10:28687405-28687427 AATTGCCCCTGAGAGGTCAGCGG - Intergenic
1065900045 10:30198194-30198216 AAATGGAGCTGAGAGACCAGAGG + Intergenic
1066389928 10:34970367-34970389 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1067943968 10:50679032-50679054 AAATGTCCCTGAGTGTGCATCGG - Intergenic
1069054448 10:63830090-63830112 AAATGCCCCAGAAAGAGAACAGG - Intergenic
1070865457 10:79705901-79705923 AAATGTCCCTGAGTGTGCATCGG - Intronic
1070879251 10:79844032-79844054 AAATGTCCCTGAGTGTGCATCGG - Intronic
1071209919 10:83328797-83328819 TAATACCACTGAAAGAGCAGAGG - Intergenic
1071584082 10:86802109-86802131 AAATGCTACTGAGAGAGTAAAGG - Intronic
1071632357 10:87228122-87228144 AAATGTCCCTGAGTGTGCATCGG - Intronic
1071645810 10:87360340-87360362 AAATGTCCCTGAGTGTGCATCGG - Intronic
1072304600 10:94095295-94095317 AAAGGCCCCTGAGGGACAAGGGG - Intronic
1072523711 10:96253251-96253273 AAAAGCCCCTCAGATAGCAGAGG - Intronic
1074544920 10:114394870-114394892 GAAATCTCCTGAGAGAGCAGGGG - Intronic
1075969520 10:126640608-126640630 AAATGCCCTGGAGAGACCTGGGG + Intronic
1076430864 10:130401137-130401159 AGCTACCCCAGAGAGAGCAGTGG - Intergenic
1077589486 11:3480558-3480580 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1078056109 11:8010202-8010224 CAATGCCCATCAGAGAGCATCGG - Intergenic
1081190481 11:40098163-40098185 ACAGGCCCCTGAGATGGCAGAGG + Intergenic
1082161152 11:48889214-48889236 AAATGAACCTCAGAGAGGAGAGG + Intergenic
1082565491 11:54673032-54673054 AAATGCTCCTGAATGATCAGTGG + Intergenic
1083068357 11:59949293-59949315 AAATGCACCTTAGGGAACAGAGG + Intergenic
1083583525 11:63839847-63839869 AAAGGCCCCTGAGAGAAAAAGGG - Intronic
1084228210 11:67730799-67730821 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1084245207 11:67852332-67852354 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1084261612 11:67982487-67982509 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1084827481 11:71742246-71742268 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1089398232 11:118149612-118149634 GCATGCCCCTGAGACAGCATGGG + Intronic
1089890341 11:121874486-121874508 AAATGCCACAGAGCGAGCAGGGG + Intergenic
1089959629 11:122604473-122604495 AAAAGCCAATGAGAGGGCAGGGG - Intergenic
1090003914 11:122983977-122983999 GAATGTCCCTTTGAGAGCAGGGG + Intergenic
1092432901 12:8423049-8423071 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1092435494 12:8443678-8443700 AAGTGCCCCTGAGAGAGCAGCGG - Intergenic
1093557496 12:20493512-20493534 AAATTCCCCTGAGATACCAAGGG + Intronic
1093593559 12:20936047-20936069 ATATGCTCCTGAATGAGCAGAGG - Intergenic
1094272323 12:28630471-28630493 CAGTGCACCTCAGAGAGCAGGGG - Intergenic
1097734222 12:63164458-63164480 AAATGCCAGTAAGAGAGGAGAGG - Intergenic
1098584481 12:72139788-72139810 AAATGCCCTTGACCGAGAAGAGG - Intronic
1100297671 12:93277838-93277860 AAATGCCCCACAGTGAGCAATGG - Intergenic
1102725227 12:115058147-115058169 AACTGCCCCTGAGGAAGCACAGG - Intergenic
1103348543 12:120266665-120266687 TAATGCCCGTGACAGAGAAGGGG + Intergenic
1104292394 12:127482371-127482393 AAATGCCCCTGAGAGAGCAATGG + Intergenic
1105276188 13:18929175-18929197 AAAGGCCCCTGACAAAGCACTGG + Intergenic
1105732655 13:23233951-23233973 AAATGCCCCTGAGAATGCAAAGG + Intronic
1107228451 13:38079508-38079530 ACATGCTCCTGAGTGACCAGTGG + Intergenic
1107544665 13:41424577-41424599 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1107621953 13:42242444-42242466 AAATATACCTGACAGAGCAGAGG + Intronic
1107765502 13:43730062-43730084 GAATGCCCCTGAGAGTGATGAGG - Intronic
1111370644 13:87312386-87312408 ATATGCCCCTGAGATAGAAGAGG - Intergenic
1113424790 13:110199164-110199186 ATGTGCCCCTGGGAGAGCTGAGG + Intronic
1117038292 14:51748630-51748652 AAATACCCCTGAGAGAGCAGCGG + Intergenic
1117889663 14:60405691-60405713 AAATGCCCCTGGGAGAGAACAGG - Intronic
1118549010 14:66928774-66928796 ATATGCTCCTGAAAGACCAGTGG - Intronic
1118685405 14:68285717-68285739 AAATGCCCCTGAGATGCCTGAGG + Intronic
1119130202 14:72165033-72165055 AAGTGCCCCTTAGACAGAAGAGG - Intronic
1121410161 14:93744141-93744163 AAATGAGGCTGAGAGACCAGAGG - Intronic
1121635978 14:95454147-95454169 GGATGCTCCCGAGAGAGCAGAGG - Intronic
1122379591 14:101292856-101292878 ACATGGCCCTGGGACAGCAGAGG - Intergenic
1124081110 15:26498160-26498182 ATATGCTCCTGAGTGACCAGTGG - Intergenic
1124236157 15:27990871-27990893 AGATGACCCTGATAAAGCAGCGG + Intronic
1124454334 15:29826922-29826944 ACAGGACCCTGTGAGAGCAGAGG - Intronic
1125141452 15:36412849-36412871 AGATGCCCCTGAGAGTAGAGGGG - Intergenic
1125885795 15:43228608-43228630 AAATGCCCCAGATAGAAGAGTGG - Intergenic
1126685576 15:51246338-51246360 AAATGACCCTGAGAGGGCAGTGG - Intronic
1128654910 15:69453319-69453341 AAGTGTCCCTGAGAGAGACGAGG - Intronic
1129241599 15:74255490-74255512 AACTGGCCCTGAGTGAGGAGAGG + Intronic
1130002413 15:80059394-80059416 AAGCGCCCCAGAGAGGGCAGTGG + Intergenic
1130286402 15:82558674-82558696 AAATGCCAGTGAGAAAACAGAGG - Intronic
1132248313 15:100315004-100315026 AAATGCCTCTGAGGGACAAGGGG + Intronic
1133558557 16:6928382-6928404 AAAGGGCCCTGTGGGAGCAGAGG + Intronic
1133875031 16:9725984-9726006 AAATGCCCCCAACATAGCAGTGG + Intergenic
1134032850 16:11006394-11006416 AGATGGCCTTGAGAGAGAAGGGG - Intronic
1134423002 16:14111988-14112010 CAATGCCCTTGAGAGATCAGGGG - Intronic
1135187268 16:20326121-20326143 AAATTCCTCTGAAAGGGCAGTGG - Intronic
1135621045 16:23955752-23955774 AACTGCCCATGAGTGACCAGGGG + Intronic
1138027737 16:53535836-53535858 AAATGACCCTGGGAGAGGCGTGG - Intergenic
1138426794 16:56939903-56939925 AAAAGCCCCTGATGCAGCAGTGG - Exonic
1139920549 16:70457240-70457262 AAATGCCCCAGAGAGTCCAATGG - Intronic
1140486443 16:75297401-75297423 AAATGTCCCTGAAAGAGGAAGGG + Intronic
1140754987 16:78058976-78058998 AAATGCCCCTGAGAGAGCAGCGG - Intronic
1143161269 17:4872995-4873017 AACTGCCGCTGTGTGAGCAGAGG - Intronic
1143257031 17:5566419-5566441 ATATGCTCCTGAGTGACCAGTGG - Intronic
1143594040 17:7903538-7903560 AAGTACTCCTGAGAGAGCAGGGG - Intronic
1145290614 17:21542701-21542723 AGAGTGCCCTGAGAGAGCAGGGG - Intronic
1145928918 17:28670088-28670110 CTATGCTCCTGAGAGAACAGAGG + Intronic
1147957956 17:44147997-44148019 CAAAGCCTCTGAGGGAGCAGTGG - Exonic
1149659660 17:58327677-58327699 AACTGACCCTGAAGGAGCAGAGG - Exonic
1150461941 17:65360891-65360913 AAATGCCCCTCATAGTGCAATGG + Intergenic
1150933471 17:69610508-69610530 AAATGCCCCTAACAGTTCAGTGG - Intergenic
1151330610 17:73404831-73404853 AATTCCCCCTTAGAGAGCAGAGG + Intronic
1151367350 17:73626210-73626232 AATTGCGCCTGAGCGAGCTGGGG + Intronic
1152070854 17:78132952-78132974 AAATGTCCCTGGAGGAGCAGAGG - Intronic
1152710248 17:81867714-81867736 AAATGCCCCTGAAGGAGCTGGGG - Exonic
1153466525 18:5394565-5394587 AAATGCCAGTGAGAGAACAGAGG + Intronic
1155122020 18:22830950-22830972 AAATGTCCCTGTGAGAGGAGAGG - Intronic
1155122034 18:22831104-22831126 AAATGTCCCTGTGAAAGGAGAGG - Intronic
1155443691 18:25888031-25888053 ATATGCTCCTGAAAGACCAGTGG + Intergenic
1155534170 18:26798778-26798800 ATATGCCCCTGAAAGGCCAGTGG + Intergenic
1159135787 18:64335408-64335430 TAAAGCCCCTGAGAGAGTAAAGG - Intergenic
1159270894 18:66149021-66149043 AATTGTCCCTGAGAGAGCTCAGG - Intergenic
1160175262 18:76588576-76588598 AAATGCCTCTGAGGAAGAAGTGG - Intergenic
1164480550 19:28608110-28608132 AAACGTCCCTGAGAGAGCAATGG + Intergenic
1164656336 19:29924723-29924745 CCATGCCCCTGTGAGAGCCGGGG + Intronic
1165226715 19:34360042-34360064 ATGTGGCCCTGAGAGAGGAGCGG - Intronic
1165333552 19:35154522-35154544 GGACGCCTCTGAGAGAGCAGGGG - Intergenic
1165633825 19:37323700-37323722 AAAGGCCCCTGAGAAATCAGGGG + Intronic
1165821596 19:38679959-38679981 AAATGCCCATGTGTAAGCAGTGG - Intronic
1167123384 19:47532385-47532407 TGATGCACCTGAGACAGCAGAGG - Intronic
1167447162 19:49544377-49544399 AAATGGCCCTGAGGCAGGAGTGG + Intronic
1167667310 19:50830377-50830399 AAAGGCCCCCGTGAGACCAGGGG + Intronic
1168633653 19:57976840-57976862 GAATGCCACTTACAGAGCAGAGG - Intergenic
926805951 2:16711199-16711221 ATATGCCCCATAGAGAGCACGGG + Intergenic
929093751 2:38244891-38244913 AAATTCTCCTGAGAGAGGAGAGG + Intergenic
930518034 2:52432365-52432387 AAATGCCCCTGAGAGAGCAATGG + Intergenic
931079177 2:58750393-58750415 AAATGTAGCTGAGAGAGCAGGGG - Intergenic
931699522 2:64898472-64898494 AAATGCCTCTGAGAGAGCAATGG - Intergenic
932349424 2:71020443-71020465 AAATGTCCCCGAGAGAACAGCGG + Intergenic
932353006 2:71046932-71046954 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
932568808 2:72925773-72925795 AAATGCCACTGAAGGAGGAGAGG - Intronic
932660092 2:73644195-73644217 AGAGGCCCATGAGACAGCAGTGG + Intergenic
932666661 2:73703876-73703898 AGAGGCCCATGAGACAGCAGTGG + Intergenic
933262745 2:80148513-80148535 CAATGCACCCGAGAGAGCAGAGG + Intronic
934165344 2:89289116-89289138 AACTGCCCATCAGAGTGCAGGGG - Intergenic
934201930 2:89893346-89893368 AACTGCCCATCAGAGTGCAGGGG + Intergenic
935197225 2:100824476-100824498 CAATGCCCCTCAAAGAGGAGAGG - Intronic
937606633 2:123808293-123808315 TAATACCTCTGAGAGAACAGAGG + Intergenic
938382558 2:130844689-130844711 ACATGCCCCTGAGAGTGAAGGGG - Intronic
938450614 2:131415802-131415824 AAATGCCCATGAGAGAGAATGGG - Intergenic
940482658 2:154254904-154254926 AAGTGCCCCTGAGAGACCCTTGG + Intronic
940871704 2:158866228-158866250 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
940873926 2:158882231-158882253 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
942135003 2:172916389-172916411 AACAGGCCCAGAGAGAGCAGAGG - Intronic
943459770 2:188157583-188157605 AAATGTCACTGAGAGAACAAAGG - Intergenic
944277069 2:197851188-197851210 AAATAAACCTAAGAGAGCAGCGG + Intronic
944516058 2:200512812-200512834 AAATGCCACTGAGAAATCAAGGG + Intronic
945425586 2:209696223-209696245 AGCTTCCCCTGAGAGAGAAGAGG + Exonic
946531011 2:220570389-220570411 GAATACCACTCAGAGAGCAGAGG - Intergenic
947209170 2:227691155-227691177 ATATGCCCCTGAATGACCAGTGG + Intronic
947594501 2:231402355-231402377 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
948300620 2:236904094-236904116 AAATGCCCCTGAGTGTGCCAAGG - Intergenic
948548843 2:238753819-238753841 TAATTCCTCTCAGAGAGCAGAGG - Intergenic
948615989 2:239199287-239199309 AAAAGCCACCCAGAGAGCAGGGG - Intronic
948629805 2:239294797-239294819 ACATGACCCTGAGGGAGGAGTGG - Intronic
1169128253 20:3146767-3146789 AAATGCCCTTCAGAGAGCAGAGG + Exonic
1169920498 20:10730140-10730162 ATATGAGGCTGAGAGAGCAGTGG + Intergenic
1170115447 20:12853642-12853664 AAAAGCCCCTGAGAGGCCACTGG + Intergenic
1170567712 20:17616202-17616224 AAAGGCCCCTGAGGTTGCAGAGG - Intronic
1172015373 20:31869976-31869998 AACAGCCCCGGAGAGAGCCGAGG + Intronic
1172760561 20:37318329-37318351 AAATGAGGCTGGGAGAGCAGGGG + Intergenic
1173414671 20:42845059-42845081 AGATGCCCCTGTGGGAGAAGGGG + Intronic
1176918111 21:14650417-14650439 ATATGCTCCTGAGTGACCAGTGG + Intronic
1178138351 21:29653903-29653925 AAATGTCTTTGAGAGTGCAGAGG - Intronic
1181556363 22:23673926-23673948 AGAAGCCCTTGAGAGAGCCGTGG - Intergenic
1181915159 22:26273934-26273956 AGAGTCACCTGAGAGAGCAGGGG + Intronic
1183581393 22:38728604-38728626 AAATGCCCCTCCAAGACCAGGGG - Intronic
1184983231 22:48110333-48110355 AGATGCCAGTGAGAGAACAGAGG + Intergenic
949185850 3:1190680-1190702 AAATACTCCTCAGAGAACAGCGG + Intronic
949573107 3:5312229-5312251 AAATGCCCCAGCCTGAGCAGTGG - Intergenic
949882138 3:8670175-8670197 AACTGGCCCTGAGAGAGCAGCGG + Intronic
949882547 3:8673399-8673421 AAATGCCACTGAGAGACCAGCGG + Intronic
951130150 3:19032919-19032941 ATATGCTCCTGAGTGACCAGTGG + Intergenic
952543496 3:34394287-34394309 ACATGCTCCTGAAAGACCAGTGG - Intergenic
954445221 3:50542705-50542727 GGATGCTCCTGAGGGAGCAGAGG + Intergenic
954689992 3:52390700-52390722 CACAGCCCCTGAGAGAGCACAGG - Intronic
956192714 3:66622496-66622518 CAAAGCCACAGAGAGAGCAGAGG - Intergenic
957044891 3:75365864-75365886 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
957076683 3:75608060-75608082 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
960471456 3:118071419-118071441 ATATGCCCCTGAATGACCAGTGG - Intergenic
960717473 3:120591569-120591591 AAATTCACCTGAAAGAGAAGAGG + Intergenic
961081768 3:124033743-124033765 GAACCCCCCTGAGGGAGCAGCGG + Intergenic
961114311 3:124315567-124315589 CAAAGGACCTGAGAGAGCAGTGG - Intronic
961271779 3:125694904-125694926 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
961274612 3:125717129-125717151 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
961277534 3:125739761-125739783 AGATGCCCCTGAGAGAGCAGCGG + Intergenic
961639266 3:128354716-128354738 AAATGCCACAAAGACAGCAGAGG - Intronic
961652226 3:128422339-128422361 TGATCCCCCTGACAGAGCAGTGG - Intergenic
961893321 3:130148077-130148099 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
963119527 3:141764450-141764472 AAATGCTGCTGAGAGGTCAGTGG - Intergenic
963347942 3:144118492-144118514 TGATGCCCTTGAGAGAGCAAAGG - Intergenic
963759551 3:149273422-149273444 AAATTCCTCTAGGAGAGCAGAGG + Intergenic
963982583 3:151556385-151556407 AAACTCCCATGAGAGAGCAAGGG - Intergenic
964489144 3:157216328-157216350 TAAAGCCCCTAAGTGAGCAGTGG - Intergenic
965321691 3:167259732-167259754 AACTGCTCCTGAGTGAGCACTGG - Intronic
965432570 3:168607490-168607512 AAATGCCCCAGAGAAATCAGGGG - Intergenic
966892702 3:184418649-184418671 AAAAGCCCCTGAGTGGGCTGGGG + Intronic
967280873 3:187822428-187822450 AATAGCACCTCAGAGAGCAGGGG + Intergenic
967655793 3:192046922-192046944 AAATGCTCCTGAATGACCAGTGG + Intergenic
967804614 3:193704405-193704427 AAATGTCCCAGAGGGAGGAGAGG - Intergenic
968989166 4:3897104-3897126 AAATGCCCCTGAGAGAGCAGGGG - Intergenic
969024840 4:4164748-4164770 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
969025737 4:4170693-4170715 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
969728977 4:8942415-8942437 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
969733719 4:8973058-8973080 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
969749444 4:9099065-9099087 AAATGCCCCTGTGAGAACAGCGG + Intergenic
969785151 4:9451949-9451971 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
969793310 4:9507118-9507140 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
969826195 4:9760493-9760515 AAACGCCCCTGAGAGAGCAGCGG + Intergenic
971998821 4:34001905-34001927 AAACGCCACTTAGAGAGTAGAGG - Intergenic
972508729 4:39746828-39746850 AAATGCTACTGAGAGAGGAGAGG - Intronic
973853036 4:54980605-54980627 ATATGCCCCTGAATGACCAGTGG + Intergenic
974867658 4:67600258-67600280 AAATGCTCCTGAATGACCAGTGG - Intronic
979757198 4:124356010-124356032 ATATGCTCCTGAGTGACCAGTGG + Intergenic
980439864 4:132827783-132827805 CAATCCCCCTAAGAGAGAAGCGG - Intergenic
980538847 4:134166436-134166458 AAATGCCCCTAAGCCTGCAGAGG + Intergenic
981154097 4:141413614-141413636 GAATTCTCTTGAGAGAGCAGAGG + Intergenic
981604514 4:146527505-146527527 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
981895920 4:149799228-149799250 ATATGCTCCTGAAAGACCAGTGG + Intergenic
984199998 4:176707130-176707152 AAATGCCCATGAAAGATGAGTGG - Intronic
986164177 5:5259096-5259118 CAGTGTCCCTGAGATAGCAGTGG - Intronic
989970424 5:50517979-50518001 ATATGCTCCTGAGTGACCAGTGG - Intergenic
990186153 5:53212164-53212186 AGGTGCCCCTGAGTGACCAGGGG - Intergenic
990229474 5:53696310-53696332 AGATGCTCCTGAGAAAGCAATGG + Intergenic
992067883 5:73123952-73123974 GGATGCCTCTGAGAGAGAAGAGG + Exonic
993815179 5:92534957-92534979 AAATGCCCAAGAAAGAGCAAAGG + Intergenic
996982558 5:129517035-129517057 ATATGCTCCTGAAAGACCAGTGG - Intronic
997749182 5:136328188-136328210 AAATCCCCCTGAGAAAGCTGAGG - Intronic
999889441 5:155960596-155960618 AAATGCACCTGAGAAAGGAGAGG + Intronic
1000111462 5:158112077-158112099 AAATAGGCCTGATAGAGCAGTGG - Intergenic
1000269394 5:159669179-159669201 AAATGCACCTGACAGAGAAAAGG + Intergenic
1000342551 5:160288984-160289006 ACTTGCCCCTCAGAGAGCATGGG + Intronic
1001340706 5:170842276-170842298 AAATACCCCTGAAAGAGAAGGGG + Intergenic
1003945301 6:11070119-11070141 AAGAGACCATGAGAGAGCAGAGG + Intergenic
1005816202 6:29554619-29554641 AAATGCCCCGGGGAGGGCACTGG - Intergenic
1005920185 6:30394612-30394634 AGAGGCCACTGAGCGAGCAGCGG + Intergenic
1005931938 6:30490705-30490727 AATTGCCCCTGAGAGAGGTCTGG - Intronic
1006244988 6:32725177-32725199 ACATCCCCATGAAAGAGCAGTGG + Intergenic
1007240163 6:40419114-40419136 AAAGCCCCCTTAGAGGGCAGTGG - Intronic
1007356440 6:41321306-41321328 AAATGAGCATGAGAGAGGAGTGG - Intergenic
1007394640 6:41570527-41570549 AAATTCCCCTAGGAGGGCAGAGG + Intronic
1008192637 6:48478504-48478526 AAATGCTCCTGAATGACCAGTGG + Intergenic
1008781664 6:55113895-55113917 AAATGCCCATGAACCAGCAGTGG + Intronic
1009044268 6:58218729-58218751 AAATGGACCTGAGGCAGCAGTGG + Intergenic
1009220094 6:60972994-60973016 AAATGGACCTGAGGCAGCAGTGG + Intergenic
1010108758 6:72199578-72199600 AAATGCTCTGGAGAGGGCAGAGG + Intronic
1010294991 6:74185272-74185294 AAATGCCCATGAGAGAAAATAGG + Intergenic
1011564857 6:88663779-88663801 AAATGCCCCTAAGAGAGCAACGG + Intronic
1011696142 6:89914798-89914820 AAATGCTCCTGAATGAGCAAAGG - Intergenic
1011708490 6:90027207-90027229 AAATGCCCTTCAGAGAACACGGG + Intronic
1012612170 6:101230250-101230272 AAATGCCCTTAAGAGAGCAATGG - Intergenic
1013415712 6:109922673-109922695 AAAAGTCCCTGAGAGGGCAGTGG + Intergenic
1015578458 6:134698250-134698272 ATATGCTCCTGAATGAGCAGTGG - Intergenic
1015949787 6:138540654-138540676 AACTGCCCTTGTGGGAGCAGAGG + Intronic
1016127628 6:140425191-140425213 AAATGCTCCTGAACGACCAGTGG - Intergenic
1016494303 6:144642588-144642610 AGAGTCCCCTGAGAGAGTAGAGG - Intronic
1016577134 6:145582559-145582581 AAAGGCAGCTGAGAGAGAAGGGG - Intronic
1017949394 6:159123337-159123359 GGATGGCCCTGAGAAAGCAGTGG - Intergenic
1018040653 6:159918890-159918912 AAATGACCCCGAGTGACCAGAGG + Intergenic
1018309317 6:162491968-162491990 AGATGGCCCAGAGACAGCAGAGG - Intronic
1018499975 6:164396681-164396703 ACAAGCCCCTCAGAGGGCAGAGG - Intergenic
1020307550 7:6846389-6846411 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1020312011 7:6875208-6875230 ACATGCCCCTGAGAGAGCAGCGG - Intergenic
1020323550 7:6957574-6957596 AAATGCCCCTGTGAGAACAGCGG - Intergenic
1020756864 7:12213848-12213870 GAATGCCCTTGACAGAGAAGCGG - Intronic
1020878368 7:13727310-13727332 ACATGTCCAGGAGAGAGCAGGGG + Intergenic
1021894282 7:25219624-25219646 AAATGCTCCTGAGGGTGGAGTGG - Intergenic
1022677835 7:32516460-32516482 AAATGCCCTTTAGGGAGCTGAGG - Intronic
1022740209 7:33113126-33113148 AAATGCCCCTCAGACAGTACAGG - Intergenic
1022873966 7:34508814-34508836 AAATGCACCTGAGAAATAAGTGG + Intergenic
1025094652 7:56087769-56087791 TAACGCCCCTGGGAGTGCAGAGG + Exonic
1025683658 7:63699377-63699399 TAATGCCCCTGGGAGTGCAAAGG - Intergenic
1026115121 7:67489472-67489494 AAATCCCCCTGAGATAGGAAAGG - Intergenic
1026287654 7:68977418-68977440 AATAACCCCTGAGAGAGAAGAGG + Intergenic
1026592202 7:71706691-71706713 AAGTGCCCTTGAGAGAGATGTGG - Intronic
1028138848 7:87249593-87249615 AAGTGGCCCTGAGTTAGCAGTGG + Intergenic
1028582004 7:92418190-92418212 AAATGCCTATGAGAGAAAAGAGG - Intergenic
1028722007 7:94043841-94043863 GAATGCCCTTCAGAGACCAGTGG + Intergenic
1028741375 7:94279638-94279660 AAATGGCACTGAGAGAGGACTGG + Intergenic
1029078666 7:97955328-97955350 AAACGCCCCTGAGAGAGCAGCGG - Intergenic
1029594628 7:101530754-101530776 AAATGCCCCAGATGGGGCAGAGG - Intronic
1030131193 7:106201958-106201980 AAATGCCCTTGGAAGAGGAGTGG - Intergenic
1030609722 7:111676108-111676130 TAATGCCGCTCAGAGTGCAGTGG - Intergenic
1031383509 7:121117597-121117619 AAATGCATCTGAGAGAGCTGTGG - Intronic
1031758894 7:125684730-125684752 AAATGCTCCTGAATGACCAGTGG + Intergenic
1032193644 7:129778171-129778193 AAATGCCCCTGAGGTCCCAGGGG + Intergenic
1032442577 7:131953372-131953394 CAATGTGCCTGAGAGAGCTGGGG - Intergenic
1034380175 7:150685303-150685325 AGATGCCACTGGGAGAGAAGAGG - Intergenic
1034481443 7:151322817-151322839 ACATGTCCCTTAGAAAGCAGAGG - Intergenic
1035114759 7:156515480-156515502 TAAGGCCCCTTAGAGAGCATCGG - Intergenic
1036239349 8:7069158-7069180 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1036262538 8:7251967-7251989 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1036304049 8:7587591-7587613 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1036314577 8:7710506-7710528 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1036354904 8:8035583-8035605 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1036372516 8:8173409-8173431 AAATGCTCCTGAGAGAGCAGCGG + Intergenic
1036817444 8:11912767-11912789 AAATGCCCCTGAGAGAGCAGTGG - Intergenic
1036820409 8:11935347-11935369 AAATGCCCCTGAGAGAGCAGTGG - Intergenic
1036878387 8:12492232-12492254 AAATGCTCCTGAGAGAGCAGCGG - Intergenic
1036904003 8:12692370-12692392 AAATGCCCCTGATAGAGCAGGGG - Intergenic
1036906470 8:12712040-12712062 AAATGCCCCCGAGAGAGCAGCGG - Intergenic
1037783695 8:21889176-21889198 TAATGCCCTTCAGAGAGAAGAGG + Intergenic
1038304986 8:26392004-26392026 AACATCCCCTGAGAAAGCAGAGG - Intronic
1038798627 8:30730213-30730235 AAATGCCCTTGAGAGAGCAGCGG + Intergenic
1039277884 8:35953113-35953135 AAATGCCCCTGAGAGAGCAATGG + Intergenic
1041193259 8:55374671-55374693 AAATGCCCTTGAGGGACCTGTGG + Intronic
1042488184 8:69369527-69369549 TCATTCCCCTGAGATAGCAGAGG - Intergenic
1043550881 8:81371360-81371382 AAAGGTCCATGAGGGAGCAGGGG + Intergenic
1050510237 9:6386597-6386619 ATATGCTCCTGAATGAGCAGTGG + Intergenic
1051001407 9:12287010-12287032 AATTGACCCTGTGAGAGGAGGGG + Intergenic
1051533384 9:18130192-18130214 AAATGCCCCTGTGAAGGCAGAGG - Intergenic
1052276452 9:26682073-26682095 AAATGCAGCTGAGAGTGCTGTGG - Intergenic
1052801329 9:32970751-32970773 AAATAACCCTGACACAGCAGAGG + Intergenic
1053063753 9:35051844-35051866 AAATTCCCCTGAAAGTTCAGTGG - Intergenic
1055134921 9:72817544-72817566 AAAAGCCACTGATAGAACAGTGG - Intronic
1055227623 9:74018527-74018549 ATATGCCCCTGAATGACCAGTGG + Intergenic
1056007630 9:82289533-82289555 AAATGCTCCTGAATGACCAGTGG + Intergenic
1056193122 9:84204426-84204448 AAATGTCCATGAGAGAACACTGG + Intergenic
1056838459 9:89977611-89977633 AAATTCCTTTGAGAGAACAGGGG - Intergenic
1056865332 9:90223686-90223708 AAATGCCCCTGAGAGAGCAGCGG + Intergenic
1056917678 9:90759201-90759223 AAATGCCCCTGAGAGAGCAGCGG - Intergenic
1057766682 9:97925997-97926019 TAATGAACATGAGAGAGCAGTGG - Intergenic
1058770904 9:108230747-108230769 AACTGCTCCTGAGAGAGCACTGG + Intergenic
1060115493 9:120936926-120936948 AGAGGCCCTTGGGAGAGCAGAGG - Intergenic
1060328980 9:122647327-122647349 AAATGCTCCTGAATGACCAGTGG + Intergenic
1060527422 9:124328388-124328410 AAATAGCCCTGAGAAAGCAGGGG - Intronic
1060712995 9:125889537-125889559 AAATGCCACTGAGAGCGGAGCGG - Intronic
1062195013 9:135268141-135268163 TAATTCCCCTTAGAGTGCAGAGG - Intergenic
1186392219 X:9172576-9172598 AGTTGACCCTGAGAGAGGAGAGG + Intergenic
1186911350 X:14170633-14170655 ACATGCCCTTGAAAGACCAGTGG - Intergenic
1187278633 X:17838946-17838968 AGTTGGCCCTGAGAGGGCAGGGG - Intronic
1189301215 X:39953902-39953924 TAGTGCCCCAGAGGGAGCAGAGG - Intergenic
1190274100 X:48889340-48889362 AAATGCCACTAAGAGAGCAGCGG + Intergenic
1190315396 X:49147360-49147382 AAATGCCCCTGAGAGAGCAACGG - Intergenic
1192135399 X:68594001-68594023 ATATGCTCCTGAGTGACCAGTGG + Intergenic
1192138028 X:68623436-68623458 ATATGCTCCTGAGTGACCAGTGG - Intergenic
1192821484 X:74650318-74650340 ATATGCTCCTGAAAGACCAGTGG - Intergenic
1193018098 X:76758585-76758607 AAATGCCCACGAGAGAACACAGG + Intergenic
1193415670 X:81220871-81220893 ATATGCTCCTGAGTGAACAGTGG - Intronic
1193665689 X:84313243-84313265 ATATGCCCCTGAATGACCAGTGG + Intergenic
1193995683 X:88364195-88364217 ACCTGCCACTGAGAGACCAGAGG + Intergenic
1194400053 X:93431311-93431333 AAATGCCCCTGAGAGAGCAGTGG + Intergenic
1195936893 X:110134185-110134207 TAGAGCCCTTGAGAGAGCAGGGG - Intronic
1195958287 X:110358121-110358143 AAATGCCTCAAAGACAGCAGTGG - Intronic
1196219134 X:113090787-113090809 ACATGCCCCTGAATGAGCATTGG + Intergenic
1196573538 X:117291371-117291393 ATATGCACCTGAGTGACCAGTGG + Intergenic
1197458235 X:126704960-126704982 AAATGCTCCTAAAAGACCAGTGG + Intergenic
1197534497 X:127671024-127671046 CATTGCCTCTGAGAGGGCAGGGG - Intergenic
1198654633 X:138900169-138900191 AAATGCAGCTGAGAGTCCAGTGG - Intronic
1200925161 Y:8647722-8647744 AAAGGCCCCTGAAGGAACAGTGG + Intergenic
1200933011 Y:8714274-8714296 AAATGTGCCTGAGAGAGCAGTGG + Intergenic
1200947874 Y:8864384-8864406 AAATGCCCCTGAGAGAGCAGTGG + Intergenic
1201385680 Y:13437244-13437266 AAATGCCGCTCAGAGAGACGTGG + Intronic
1201597220 Y:15684048-15684070 AAATGCCCATGAGAGAAAACAGG - Intergenic