ID: 1056865842

View in Genome Browser
Species Human (GRCh38)
Location 9:90226809-90226831
Sequence TCACGCTCCATGCACTTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056865842_1056865847 11 Left 1056865842 9:90226809-90226831 CCCTTCAAGTGCATGGAGCGTGA No data
Right 1056865847 9:90226843-90226865 GGGCCTGCCTATTGAACTCTGGG No data
1056865842_1056865848 12 Left 1056865842 9:90226809-90226831 CCCTTCAAGTGCATGGAGCGTGA No data
Right 1056865848 9:90226844-90226866 GGCCTGCCTATTGAACTCTGGGG No data
1056865842_1056865849 13 Left 1056865842 9:90226809-90226831 CCCTTCAAGTGCATGGAGCGTGA No data
Right 1056865849 9:90226845-90226867 GCCTGCCTATTGAACTCTGGGGG No data
1056865842_1056865846 10 Left 1056865842 9:90226809-90226831 CCCTTCAAGTGCATGGAGCGTGA No data
Right 1056865846 9:90226842-90226864 AGGGCCTGCCTATTGAACTCTGG No data
1056865842_1056865845 -9 Left 1056865842 9:90226809-90226831 CCCTTCAAGTGCATGGAGCGTGA No data
Right 1056865845 9:90226823-90226845 GGAGCGTGATAGAAAGAAAAGGG No data
1056865842_1056865844 -10 Left 1056865842 9:90226809-90226831 CCCTTCAAGTGCATGGAGCGTGA No data
Right 1056865844 9:90226822-90226844 TGGAGCGTGATAGAAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056865842 Original CRISPR TCACGCTCCATGCACTTGAA GGG (reversed) Intergenic
No off target data available for this crispr