ID: 1056865849

View in Genome Browser
Species Human (GRCh38)
Location 9:90226845-90226867
Sequence GCCTGCCTATTGAACTCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056865842_1056865849 13 Left 1056865842 9:90226809-90226831 CCCTTCAAGTGCATGGAGCGTGA No data
Right 1056865849 9:90226845-90226867 GCCTGCCTATTGAACTCTGGGGG No data
1056865843_1056865849 12 Left 1056865843 9:90226810-90226832 CCTTCAAGTGCATGGAGCGTGAT No data
Right 1056865849 9:90226845-90226867 GCCTGCCTATTGAACTCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056865849 Original CRISPR GCCTGCCTATTGAACTCTGG GGG Intergenic
No off target data available for this crispr