ID: 1056871718

View in Genome Browser
Species Human (GRCh38)
Location 9:90288023-90288045
Sequence TGGCTGGGGCAGGCTCTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056871718_1056871725 2 Left 1056871718 9:90288023-90288045 CCCATCAGAGCCTGCCCCAGCCA No data
Right 1056871725 9:90288048-90288070 GAGACAGCATCCTATTCTACTGG No data
1056871718_1056871728 18 Left 1056871718 9:90288023-90288045 CCCATCAGAGCCTGCCCCAGCCA No data
Right 1056871728 9:90288064-90288086 CTACTGGAACTCTTTCCCTCGGG No data
1056871718_1056871729 19 Left 1056871718 9:90288023-90288045 CCCATCAGAGCCTGCCCCAGCCA No data
Right 1056871729 9:90288065-90288087 TACTGGAACTCTTTCCCTCGGGG No data
1056871718_1056871731 29 Left 1056871718 9:90288023-90288045 CCCATCAGAGCCTGCCCCAGCCA No data
Right 1056871731 9:90288075-90288097 CTTTCCCTCGGGGTCTGCTTGGG No data
1056871718_1056871727 17 Left 1056871718 9:90288023-90288045 CCCATCAGAGCCTGCCCCAGCCA No data
Right 1056871727 9:90288063-90288085 TCTACTGGAACTCTTTCCCTCGG No data
1056871718_1056871730 28 Left 1056871718 9:90288023-90288045 CCCATCAGAGCCTGCCCCAGCCA No data
Right 1056871730 9:90288074-90288096 TCTTTCCCTCGGGGTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056871718 Original CRISPR TGGCTGGGGCAGGCTCTGAT GGG (reversed) Intergenic
No off target data available for this crispr