ID: 1056871725

View in Genome Browser
Species Human (GRCh38)
Location 9:90288048-90288070
Sequence GAGACAGCATCCTATTCTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056871720_1056871725 -8 Left 1056871720 9:90288033-90288055 CCTGCCCCAGCCACAGAGACAGC No data
Right 1056871725 9:90288048-90288070 GAGACAGCATCCTATTCTACTGG No data
1056871717_1056871725 14 Left 1056871717 9:90288011-90288033 CCACTGTGCTTTCCCATCAGAGC No data
Right 1056871725 9:90288048-90288070 GAGACAGCATCCTATTCTACTGG No data
1056871718_1056871725 2 Left 1056871718 9:90288023-90288045 CCCATCAGAGCCTGCCCCAGCCA No data
Right 1056871725 9:90288048-90288070 GAGACAGCATCCTATTCTACTGG No data
1056871716_1056871725 18 Left 1056871716 9:90288007-90288029 CCTTCCACTGTGCTTTCCCATCA No data
Right 1056871725 9:90288048-90288070 GAGACAGCATCCTATTCTACTGG No data
1056871719_1056871725 1 Left 1056871719 9:90288024-90288046 CCATCAGAGCCTGCCCCAGCCAC No data
Right 1056871725 9:90288048-90288070 GAGACAGCATCCTATTCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056871725 Original CRISPR GAGACAGCATCCTATTCTAC TGG Intergenic
No off target data available for this crispr